MSAD_210040 (gene; Medicago sativa )

Overview
NameMSAD_210040
Unique NameMSAD_210040
Typegene
OrganismMedicago sativa (alfalfa)
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
MSAD_210040.t1MSAD_210040.t1Medicago sativamRNA


Synonyms
The feature 'MSAD_210040' has the following synonyms
Synonym
augustus_masked-Scc4a34_14-processed-gene-0.0
Sequences
The following sequences are available for this feature:

gene from alignment at Scc4a34_14:10960..11283+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>MSAD_210040 ID=MSAD_210040|Name=MSAD_210040|organism=Medicago sativa|type=gene|length=324bp|location=Sequence derived from alignment at Scc4a34_14:10960..11283+ (Medicago sativa)
ATGGCCGGGTGGATCGACGTTCATGCACAATTCAACAGCGGAGAACCTCA GCGGTTGAAGGTTCAGTGTCGTGGTGTAACGCTAAGAGGTCTCAAGGATC AACTGGATGAATTCAACCAAGTAGTAAACCCCGGAGACACAAGGAAGGTG GAATGTGTTTGCTATAAACGTCCAACGCTCGACGACGGGAGAATATCATT CAGTTGGGTGGAATTAACGAACGACGAAAACGTGAAGAACATGTTTTGGG AGCACATCATGTTCCAGTGGATCGATATGCGGGTAACGTTGTTGAGATCA ACTGAAGATATATCAAGAGTCTGA
back to top
Properties
Property NameValue
NoteSubtilisin-like serine protease MAKER:12.3:0.22:Medtr1g069170
CADL Non-redundant FlagN
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Scc4a34_14supercontigScc4a34_14:10960..11283 +