MSAD_210121 (gene; Medicago sativa )

Overview
NameMSAD_210121
Unique NameMSAD_210121
Typegene
OrganismMedicago sativa (alfalfa)
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
MSAD_210121.t1MSAD_210121.t1Medicago sativamRNA


Synonyms
The feature 'MSAD_210121' has the following synonyms
Synonym
augustus_masked-Scc4a34_26-processed-gene-4.10
Sequences
The following sequences are available for this feature:

gene from alignment at Scc4a34_26:469363..469677+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>MSAD_210121 ID=MSAD_210121|Name=MSAD_210121|organism=Medicago sativa|type=gene|length=315bp|location=Sequence derived from alignment at Scc4a34_26:469363..469677+ (Medicago sativa)
ATGGTTTTGGCATTCTGGTATAGTGATGATGACGATGTTGATGATGAGAT TGAAGATTCTGGAAACCATTTCCACAGCAAAATGGTTTTGGCATTCTGGT ATAGTGATGATGACGATGTTGATGATGAGATTGAAGATTCTGGAAACCAT TTCCACAACAAAATGGTTTTGGAGTACAACTCGCAGAAACCATTTCCACA GCAAAATGGTTTTGGAGTACAACTCGCAGAAACCATTTCCACAGCAAAAT GGTTTTGGCATTCTGGGCAATGCTCTAATGGATTGCTTTTTTTCCCCCCT TTAGGAATATCATAA
back to top
Properties
Property NameValue
NotePlant invertase/pectin methylesterase inhibitor protein MAKER:13.5:0.2:Medtr1g054745
CADL Non-redundant FlagY
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Scc4a34_26supercontigScc4a34_26:469363..469677 +