MSAD_210123 (gene; Medicago sativa )

Overview
NameMSAD_210123
Unique NameMSAD_210123
Typegene
OrganismMedicago sativa (alfalfa)
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
MSAD_210123.t1MSAD_210123.t1Medicago sativamRNA


Synonyms
The feature 'MSAD_210123' has the following synonyms
Synonym
maker-Scc4a34_26-augustus-gene-5.24
Sequences
The following sequences are available for this feature:

gene from alignment at Scc4a34_26:483531..488511+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>MSAD_210123 ID=MSAD_210123|Name=MSAD_210123|organism=Medicago sativa|type=gene|length=4981bp|location=Sequence derived from alignment at Scc4a34_26:483531..488511+ (Medicago sativa)
GCACAAACTTTAAACCACTGATATGGTGAGACGGAGGGAGTATTTATGTT TCTCTCTCATAAAAAACACTAGTGTCATGTGTGCCACCAAGAACTTTCCC ACAGCTTCAATGTGAAAAAGAAGAAAAAAAAAAACACAATTTTGAAAAAT TGGTTCGGTTCGGGTCAAATATCAAGTACTGGTTTTGAATTCAGTAAACT TTTCTTTCTGAACCGAACATGGAAGCAGCGCGGCGGCTGGTGTGGCGTTT ACGTTATTTTCCGATGCCGGTGCTCTCAAACGGTGTCGCATCACTCTCTT CTTCATTTTCTAGTTGTAACACCAAAATTGAACTATTCAATACCAAATTT TCCAAGTTCGGTTCAACATTATCATCACCTTCTTCTTCTTCTTCTTCTTC TTCTTCTTCTTCAGAAACAGCATTACTAAGGAAAACTGTGAACAAATTGC CTTACATTGTAAAAGCAGGTGATCCAGTTCTTCATGAGCCTGCACGTGAG GTTGATCACAGTGAGATTAAATCAGACAAGATTCAGAATATTATTGATGA TATGATTCTTGTCATGAGAAAAGCCCCTGGAGTTGGTGTTGCTGCCCCAC AAATTGGTATCCCTTTAAGGGTATGAATCAAAAATGAGCTTTTGTTGTTA TTGTTGTCACTGACACATGTGATGAGTTATGCCATTTTCTCAAATTATTA TAAGCTGTATAGTGTCTTTGTCAATACAAAAATGGAGTAATTGAATGTAA CTACATGTGTTTTGGTAGTATCATGTTGGACAGGAAATGGATTCTCTCCT TTGAAACAAAACTATAATGTGGAGACCTTGACCATCTCCACATTATTTTC TCAATTTTTCTTTTTTTCCAATGGAGAGAATATTGACCCTATTGGACATT CTTTGGTACATTGAGGTCGGTGCCTCAATGAGAAGATAGTGGGGGTCTGA GATGACTATTAAAGAGTCTCACATTGGATGAGAGATTGCATGATCAAGTG TTTATAAGTGGGGGTAGTCCTCACCTCACATATAGATTTTGTAAGGTTGA GTTAGGCCTAACCACAAATTCTAAGATGGTATTAGAGCCCCCTCCAAGAT TGTTTAAACTGTTTGCTTCCAGGTTACGCTATCGAGCCACCCACCATTTA TACCAACGCACCAAGCCTAATAGTCTTGGGCTTGAAGGAGTGTGTTAAAA GAGTCTCGTATTGGATGAGAGATGGCATGTGTTTATAAGTGGGGCAGTTC TCACTTTACAAACATGTTTTGTGGGGTTGTGTTAGACCCAACCACAAATT CTAAGAACGATTGACTAGAGGAATCCACAACCTAGCCAAGACGGCTGATC AGGACACTTGTCCATAGGAGAGCGCTAGCATGGCCGACCAGGGTACCAGA GTGTCATTAGTTGGTAGAGTAATTTATCTGTACCGCAAGTGCCACCTACC GCTACGGCACTACTCTGTTCATCGTCCTCATTGCTAACTAAAAATAGAAT ATCTAATGGGAGCCACACCCTATTTAGTATTGGGTCTGACAATGATTGGA GAAGCCCAGGAATTTTAGGAAAGCCTAGCAGGGGGAGCACTATAAAATTG GACTTAACATTTAGGGCAAAGGCATGTTCTACACACATTTCCATAAATCA TAGGTGACCACTCGCTCATTAGGCGCTGTGTTCTAGACTAGAACAGATGC AAACACCATGTCGAACATCACACACCTTTAATGTGAAGTGTCGCTGTGTC GGTTTTACATAGGCTGATGTTGTTGGACTTAAGCATGTTTTTCCGGTGTT TTCTTTTATGTATGCAGATAATAGTTTTGGAGGATAAAGAAGAATATATT AGTTACAACACAGAGGAGGAGACCAAAGCACAAGACAGAAGACCTTTTGA TCTTTTGGTATGTATGTTTCCATATATGATGTGTGAATCAGAGAACGAAT GATAGCTTCTTTTTTTATGTTACATGTGAATGAATATTAAGAAACTGCCT TTGTGGGTCACCAAGTAACCTGGGATATGTAATGCAAGCTAAAAATCATA TGACAAATAATATAAAAGATTCTGGAAGCATGGATTGGACTATTTTAACT TGTATCAGTGGTATATTGGCTGAAAGAAGAAGCTTTCCACAGCTTGGAGT CATTTGGAAGATATAAGAATTAACTAACCAGCGTGCAATAAGATAAACCA TCTGTCAACATTTGAATAATATATACACATTTTCTATGATCAGTATGCAT GTTACTATTAATTCTAATAATTACTTGATTACATTACATTATACTACAAT TAATTGCTATTGTCTAATTGTTACAATTTGTGACTTTCCAACAGTGAAAG AGACGCCCTATATATGATTAGAAATATTTTCCTCGCACAAATTAGTAAAA TTAACTACTAGTAGTTCATTGTTTCTTCTGATCTGGCATTGGAAAATGAG CATATACATTAAATAGAAACACGGATTTGAAATTTGAAGTTAGCTATGAA TTGCATTGCAGTCATTAAGATGCAAGTTATTGTAAACCAGAGGGGTGATC GAAACCTGGATGCAGCTACTCGGTCCAATTTCAAGGGCCTTTCACTCTCT AAGAAGTAGCTAATTACGTTTAACGACTAGTGCATGTTCAAAAGCTATCA TTTGTTCATTATAAAAAAAGTAACCGTTCATTCATTTATTGAAATTAAAT TCAGTTTTGTTTTGTACATGAGATATATTACTTGAGTAATAACATTCATT CAGTAGATCTCTTGACTGATGCAGGTGATTCTGAATCCCAAATTAAAGAA CAAGAGCAACAGGAATGCCTTCTTTTTTGAAGGGTGCTTGAGGTGTGGCA ATAATTTACTAACAACTTTTTCATTTTCTGTTGCCATACTTGCAATTTCA AAACTGACATGCCATTTGTTCATGGTCATATTTAGGAATGTGCAAATCTT GGTTTAATATTTAGGCTAAAATATGGTTTTAGTCCCTGCAAATATGCCTT GTTTTGATTTTAATCCCTGTAAAAAAAATTTGTTGTTTTTGGTCCCTGCA AAATATTTTGTTTTTGAAAATAGTCCCTGACCCTACTTTTGTGATGATAT GCATACGTGACACATGATGGCTGAACCTATTTCGTAGTTTTTGGTCCCTG CAAAATATTTTGTTTTTTAAAAAGGTTCCTGCAAAATATTTTGATTTTGA AAATAGTCCCTCCAGGGACTATTTTAAAAAACAAAAAATTTTGCAGGGAC CAAAAACTATTTTTTTTTTTTTACAGTGACTAAAACCAAAACGAGACATA TTTGCAGGGACTAAAACCATATTTTAGCCTAATATTTAAAATGGCAGTCT AAATTCTTGATGGTACACTGTTTGTCCTTTCTTTAGCGATGGCTTAAAAT TTCATGAGACCAAGTTCTTTTATGACTTACTTTAGCAACAACATCAAACA AGCCTGATCCCACTAAGTGGGGTTGGCTTCTGACTTTTTTTTGAATCAGG GGTTGGCTTCTGACTGACTTTAGCATTATAAGGAAAATTTGATAGGATCA ATTTTGAAGCAATCACAACCAAATCATAAAATGATTTCTCTTAACATGTA TCTTTATGTATGTGTGTGTGATTCCAAATGAACGAATTCTTCAGTGTTGA TGTTGTTTAAGCTATTATTTTGCCTAAAAGCTAAAAAGTAGCAAAGTCTT TATTCTCTTTCACTTACAAGGACTGCTCAACTGGTGATACATCTAAGTTG GCATCCATGTAACCCAATACATAGCAGAATTGCTTATGTTTATTTCAAAA CATGGTTGTTTGGTTTCACGTGGATTTTTTTCACAATGTAAGGGTTGCCT GAGGCTGAGTATACTCGGGTGGACTATGCTTAAGTTCAATTTAATCAACC TATGTCTATCTTAGTTTTAACATCTGGTATGAACTTCTCTTAGCTTTTCT TGTCTTTTTTTTAAACAAAAATGAGATCCAATATCCATTATCTTTTGTGG AGGTTGAGCTTTGCTGTACCAAATTTTCCTTTGTCAGTATTGAAGTTGCC GTTAGTATTGTTGCGAGTTCCACATTCAATGTGATATGACCCAAAAAGTG TTTATAAGTGGGAGGCATCCATCACCTTATAAACCGGTTTTGTAATGGGT TGAGTTAGGTCCAATCCAAATTCTAAGTAGAATGTACAAACATGGGTGTA GTTCACCAAAGAGGAAAGCAGCGTTTGTAACAAAACAATTGAATCTCTTA TTATGATTATTGTGTCCTCTGATTGTAAATATGCCGTGTTTGTAAGAGAT TTTCCTCTAACCTGATTAGAGTTGATTGAATTTGTTGGATCTGTTATCAG TTATGTAATATCGTTTTTAAAGTTGTCAAAATTTCAAAAATATGGTAATT CTGGCTTGCTCCATATTTTTGTGGTTTATGTGGCAATAATGTGTGCAGAA CTACATATATCCAAGTTACATTAACATCACTTGCAATAACATTTTGCAGT GTTGATCGATTTCAAGCTGTGGTAGAGCGATACCTTGATGTTGAGGTTAC AGGTTTTGATCGATATGGTGAGCCAATCAAAATAAATGCTTCTGGTTGGC AGGCTCGAATTTTACAGCATGAGTGTGATCACCTAGATGGAACACTATAT GTCGATAAGATGGTACCTAGAACTTTCAGAAGTTGGAAAAACGTGGATCT GCCTCTTGCCCATGGGTGCCCCAAACTTGGCCCCCGAGCGTAAAACTGGG ACAGCCTCTGATTCAAAACTAGTTTCATATGCACAACATTAGTGAAAAGT TTACATTTTTTGACCTTATGATGTAGTCCAGAATCTGATCCATTAAGTTA GAAGTATTGTGTCAGTTTTGTAATTAGTAAATTTCCTCAAATTTTTAGTA TTATCCTGTTGAAATCTGTTACTGCAGTCTGTTAGTACTTTCTGATCAAT TCATTAAATATAAGATTCAATAATAGGGATA
back to top
Properties
Property NameValue
NotePeptide deformylase MAKER:9.1:0.21:Medtr2g103430
CADL Non-redundant FlagY
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Scc4a34_26supercontigScc4a34_26:483531..488511 +