MSAD_210001.t1 (mRNA; Medicago sativa )

Overview
NameMSAD_210001.t1
Unique NameMSAD_210001.t1
TypemRNA
OrganismMedicago sativa (alfalfa)
Sequence length792
View on JBrowse
Gene Expression Atlas
Gene Ontology
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0042147 retrograde transport, endosome to Golgi
cellular_component GO:0005829 cytosol
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Scc4a34_2supercontigScc4a34_2:1471..5633 +
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Gene Ontology Update2017-11-12
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
Properties
Property NameValue
eAED0.27
QI0|0.25|0.11|0.33|0.75|0.88|9|0|263
AED0.27
NoteVacuolar sorting protein MAKER:11.2:0.27:Medtr2g047908
Relationships

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
MSAD_210001MSAD_210001Medicago sativagene


The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210001.t1MSAD_210001.t1-proteinMedicago sativapolypeptide


The following exon feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210001.t1:exon:0MSAD_210001.t1:exon:0Medicago sativaexon
MSAD_210001.t1:exon:1MSAD_210001.t1:exon:1Medicago sativaexon
MSAD_210001.t1:exon:2MSAD_210001.t1:exon:2Medicago sativaexon
MSAD_210001.t1:exon:3MSAD_210001.t1:exon:3Medicago sativaexon
MSAD_210001.t1:exon:4MSAD_210001.t1:exon:4Medicago sativaexon
MSAD_210001.t1:exon:5MSAD_210001.t1:exon:5Medicago sativaexon
MSAD_210001.t1:exon:6MSAD_210001.t1:exon:6Medicago sativaexon
MSAD_210001.t1:exon:7MSAD_210001.t1:exon:7Medicago sativaexon
MSAD_210001.t1:exon:8MSAD_210001.t1:exon:8Medicago sativaexon


The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210001.t1:cdsMSAD_210001.t1:cdsMedicago sativaCDS


Synonyms
The feature 'MSAD_210001.t1' has the following synonyms
Synonym
maker-Scc4a34_2-snap-gene-0.5-mRNA-1
Sequence

Variant Marked-up Sequence

>MSAD_210001.t1:1-500
        tgaggggagccaaaaccgcttcatctttcccttcccctgttttcaaaaccgctccatcttcttcttcttccctgttttctctttctggtggctgctccgatcttcttcctcacagaacagtgaaacctaaagacattttattcatggcagacaaggcacatttagtgcgggcggctgaattgctgcagcaattgcgcatggtgctgcagtgcagaaattatcccaagaaagtgaggttcatggtaccacattttttgccatattcacctcaaaagaatgttgccaagggtccatcttttcacggaaaagcaatagatgctgtgaagctcctcaaatatgtcaaaaaatttcagaggctgctaggattgaagtactgtatttcttttactgaagctgtgtttgcagcatgtgatgctgctcatgtaagatgggcaaagcttctgggggtccgtgctactctccatcctaggttgaaactgcaggagtttctaactgtttac      

FASTA Record

The following sequence is that of the mRNA without any variants taken into account.

>MSAD_210001.t1:1-500
        tgaggggagccaaaaccgcttcatctttcccttcccctgttttcaaaaccgctccatcttcttcttcttccctgttttctctttctggtggctgctccgatcttcttcctcacagaacagtgaaacctaaagacattttattcatggcagacaaggcacatttagtgcgggcggctgaattgctgcagcaattgcgcatggtgctgcagtgcagaaattatcccaagaaagtgaggttcatggtaccacattttttgccatattcacctcaaaagaatgttgccaagggtccatcttttcacggaaaagcaatagatgctgtgaagctcctcaaatatgtcaaaaaatttcagaggctgctaggattgaagtactgtatttcttttactgaagctgtgtttgcagcatgtgatgctgctcatgtaagatgggcaaagcttctgggggtccgtgctactctccatcctaggttgaaactgcaggagtttctaactgtttac