MSAD_210002.t1 (mRNA; Medicago sativa )

Overview
NameMSAD_210002.t1
Unique NameMSAD_210002.t1
TypemRNA
OrganismMedicago sativa (alfalfa)
Sequence length4302
View on JBrowse
Gene Expression Atlas
Gene Ontology
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
cellular_component GO:0016021 integral component of membrane
molecular_function GO:0005524 ATP binding
molecular_function GO:0004672 protein kinase activity
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Scc4a34_3supercontigScc4a34_3:3953..12711 -
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Gene Ontology Update2017-11-12
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
Properties
Property NameValue
eAED0.14
QI0|0|0|0.85|0.16|0.14|7|0|1434
AED0.11
NoteLRR receptor-like kinase family protein MAKER:7.9:0.11:Medtr7g007560
Relationships

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
MSAD_210002MSAD_210002Medicago sativagene


The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210002.t1MSAD_210002.t1-proteinMedicago sativapolypeptide


The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210002.t1:cdsMSAD_210002.t1:cdsMedicago sativaCDS


The following exon feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210002.t1:exon:0MSAD_210002.t1:exon:0Medicago sativaexon
MSAD_210002.t1:exon:1MSAD_210002.t1:exon:1Medicago sativaexon
MSAD_210002.t1:exon:2MSAD_210002.t1:exon:2Medicago sativaexon
MSAD_210002.t1:exon:3MSAD_210002.t1:exon:3Medicago sativaexon
MSAD_210002.t1:exon:4MSAD_210002.t1:exon:4Medicago sativaexon
MSAD_210002.t1:exon:5MSAD_210002.t1:exon:5Medicago sativaexon
MSAD_210002.t1:exon:6MSAD_210002.t1:exon:6Medicago sativaexon


Synonyms
The feature 'MSAD_210002.t1' has the following synonyms
Synonym
maker-Scc4a34_3-snap-gene-0.16-mRNA-1
Sequence

Variant Marked-up Sequence

>MSAD_210002.t1:1-500
        TGGAAGTATCAACTCAAATTGCAACCGCTAGAATTACTTCGCCAGGCAGAATTTGGCTCGCCATGGCGAGATACTTTTGTCCTGATTTTCCAACTTTCTGGACCTCTTCGCCTTTCAGCTCGCCAGTGTTTCGCCAGGCCGAATTTCTTGCCATGGCCAACTCTGTGGCGAAGTGGCCTGGAGCTCTTTGGAGGTCTTCGCCTTCCAGCTCGCCTTTGGATCGCCATGGCGAGCTTGCCTTGGTCAAATTGGTACCTCCTTCAATAGATAATCTTAGGCAATTAAACTACCTAGATATCTCTTTGAACTCTTTTCAAGGTTCCATCCCTCCCGAATTGTGGTTGCTAAAAAATCTCACTTTCTTAGATCTATCTAACAATAGATTCAAAGGTGAGATACCTTCTTCACTAGGAAATCTCAAACAATTATATGAGCTAAACATCTCTCACAACAACATTCAAGGTTCCATTCCACTTGAGTTGGGAATCCTGGAAAGTATA      

FASTA Record

The following sequence is that of the mRNA without any variants taken into account.

>MSAD_210002.t1:1-500
        TGGAAGTATCAACTCAAATTGCAACCGCTAGAATTACTTCGCCAGGCAGAATTTGGCTCGCCATGGCGAGATACTTTTGTCCTGATTTTCCAACTTTCTGGACCTCTTCGCCTTTCAGCTCGCCAGTGTTTCGCCAGGCCGAATTTCTTGCCATGGCCAACTCTGTGGCGAAGTGGCCTGGAGCTCTTTGGAGGTCTTCGCCTTCCAGCTCGCCTTTGGATCGCCATGGCGAGCTTGCCTTGGTCAAATTGGTACCTCCTTCAATAGATAATCTTAGGCAATTAAACTACCTAGATATCTCTTTGAACTCTTTTCAAGGTTCCATCCCTCCCGAATTGTGGTTGCTAAAAAATCTCACTTTCTTAGATCTATCTAACAATAGATTCAAAGGTGAGATACCTTCTTCACTAGGAAATCTCAAACAATTATATGAGCTAAACATCTCTCACAACAACATTCAAGGTTCCATTCCACTTGAGTTGGGAATCCTGGAAAGTATA