MSAD_210003.t1 (mRNA; Medicago sativa )

Overview
NameMSAD_210003.t1
Unique NameMSAD_210003.t1
TypemRNA
OrganismMedicago sativa (alfalfa)
Sequence length471
View on JBrowse
Gene Expression Atlas
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Scc4a34_3supercontigScc4a34_3:15685..16799 -
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
Properties
Property NameValue
eAED0.50
QI0|1|0|1|1|1|2|0|156
AED0.50
NoteUncharacterized protein MAKER:14.8:0.5:Medtr7g007590
Relationships

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
MSAD_210003MSAD_210003Medicago sativagene


The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210003.t1MSAD_210003.t1-proteinMedicago sativapolypeptide


The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210003.t1:cdsMSAD_210003.t1:cdsMedicago sativaCDS


The following exon feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210003.t1:exon:7MSAD_210003.t1:exon:7Medicago sativaexon
MSAD_210003.t1:exon:8MSAD_210003.t1:exon:8Medicago sativaexon


Synonyms
The feature 'MSAD_210003.t1' has the following synonyms
Synonym
maker-Scc4a34_3-augustus-gene-0.14-mRNA-1
Sequence

Variant Marked-up Sequence

>MSAD_210003.t1:1-471
        ATGATTGAAAATGTTGAAGCATTGTCGTCGCAAGTTGAGAATTTGAAAACTCGGATTGATAGCGTGAAATATGAAAATCCTGGAAAGTTCTGTTCTGCAACTCAATCGAACATAATTGGGCCGTCTAATGGATTTAATCGTTCTGTTCATAATTATGGCTCTTTTGCTGGTAAAGAAATTCCAGTTCCAGGTAGTTTTGCCGGTAAATCTGAGTTATATGCGGAAGATCAACTTATGACTGACGATGTATTATCAACTCGAGAAGGGATAACTCCTTCCATCGAATCTGCCAATAGGTCCCAGTTTGAGGTTCAGGGAGAAAATCTGGAAGAGAAATCCAATGAATCAGTTGAAGAGCAGAAATGCATTTCTTCAGCTCAAGTTTCAGACTCTGACATGCTCACTGAGAATGCTGTTCTTAATGCTCATTCTGTTAAACCATGTTCAACATCCAAGACTCATTTTCTCTAG      

FASTA Record

The following sequence is that of the mRNA without any variants taken into account.

>MSAD_210003.t1:1-471
        ATGATTGAAAATGTTGAAGCATTGTCGTCGCAAGTTGAGAATTTGAAAACTCGGATTGATAGCGTGAAATATGAAAATCCTGGAAAGTTCTGTTCTGCAACTCAATCGAACATAATTGGGCCGTCTAATGGATTTAATCGTTCTGTTCATAATTATGGCTCTTTTGCTGGTAAAGAAATTCCAGTTCCAGGTAGTTTTGCCGGTAAATCTGAGTTATATGCGGAAGATCAACTTATGACTGACGATGTATTATCAACTCGAGAAGGGATAACTCCTTCCATCGAATCTGCCAATAGGTCCCAGTTTGAGGTTCAGGGAGAAAATCTGGAAGAGAAATCCAATGAATCAGTTGAAGAGCAGAAATGCATTTCTTCAGCTCAAGTTTCAGACTCTGACATGCTCACTGAGAATGCTGTTCTTAATGCTCATTCTGTTAAACCATGTTCAACATCCAAGACTCATTTTCTCTAG