MSAD_210004.t1 (mRNA; Medicago sativa )

Overview
NameMSAD_210004.t1
Unique NameMSAD_210004.t1
TypemRNA
OrganismMedicago sativa (alfalfa)
Sequence length624
View on JBrowse
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Scc4a34_6supercontigScc4a34_6:3767..5332 +
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
Properties
Property NameValue
eAED0.18
QI0|0.5|0.66|1|1|1|3|132|163
AED0.18
NotePhosphoglycerate mutase MAKER:12.5:0.18:Medtr4g106970
Relationships

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
MSAD_210004MSAD_210004Medicago sativagene


The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210004.t1MSAD_210004.t1-proteinMedicago sativapolypeptide


The following exon feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210004.t1:exon:4MSAD_210004.t1:exon:4Medicago sativaexon
MSAD_210004.t1:exon:5MSAD_210004.t1:exon:5Medicago sativaexon
MSAD_210004.t1:exon:6MSAD_210004.t1:exon:6Medicago sativaexon


The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210004.t1:cdsMSAD_210004.t1:cdsMedicago sativaCDS


Synonyms
The feature 'MSAD_210004.t1' has the following synonyms
Synonym
maker-Scc4a34_6-augustus-gene-0.8-mRNA-1
Sequence

Variant Marked-up Sequence

>MSAD_210004.t1:1-500
        tgcctccaccacgcttaaaaccagtactatttgtgagtcggaaatcagagtttagagtatgggatgataaacaccacccgtggaaaacctctgtggataatggtttatctgatagagggaagaaacagagtatcagagctgcttttgatttgaaagaaatggatatatgcatcagatggtatatctacaaaataaaacctcctcccattgatgacggaactccaaatgagagtgttgcagatgtttttgttcgtgtgacccaactcatgtcaatccttgaaactcaatacgctggtgacacagtcgttatagtctcgccagattcggataacttgtcaatccttcaggctggtttggtaggcctagacttgcgaaggcacagggagttgtcttttgcacctggtgaagttcgccaggttgataccaatgacattcctacttacaagatgcctccatctgctgtatataaatgctccagctaccaattgtaattagctctt      

FASTA Record

The following sequence is that of the mRNA without any variants taken into account.

>MSAD_210004.t1:1-500
        tgcctccaccacgcttaaaaccagtactatttgtgagtcggaaatcagagtttagagtatgggatgataaacaccacccgtggaaaacctctgtggataatggtttatctgatagagggaagaaacagagtatcagagctgcttttgatttgaaagaaatggatatatgcatcagatggtatatctacaaaataaaacctcctcccattgatgacggaactccaaatgagagtgttgcagatgtttttgttcgtgtgacccaactcatgtcaatccttgaaactcaatacgctggtgacacagtcgttatagtctcgccagattcggataacttgtcaatccttcaggctggtttggtaggcctagacttgcgaaggcacagggagttgtcttttgcacctggtgaagttcgccaggttgataccaatgacattcctacttacaagatgcctccatctgctgtatataaatgctccagctaccaattgtaattagctctt