MSAD_210005.t1 (mRNA; Medicago sativa )

Overview
NameMSAD_210005.t1
Unique NameMSAD_210005.t1
TypemRNA
OrganismMedicago sativa (alfalfa)
Sequence length1158
View on JBrowse
Gene Expression Atlas
Gene Ontology
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
cellular_component GO:0016021 integral component of membrane
molecular_function GO:0016874 ligase activity
molecular_function GO:0008270 zinc ion binding
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Scc4a34_6supercontigScc4a34_6:10743..13377 +
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Gene Ontology Update2017-11-12
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
Properties
Property NameValue
eAED0.06
QI112|1|1|1|1|1|4|422|207
AED0.06
NoteRING-finger ubiquitin ligase MAKER:10.3:0.06:Medtr4g106960
Relationships

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
MSAD_210005MSAD_210005Medicago sativagene


The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210005.t1MSAD_210005.t1-proteinMedicago sativapolypeptide


The following exon feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210005.t1:exon:0MSAD_210005.t1:exon:0Medicago sativaexon
MSAD_210005.t1:exon:1MSAD_210005.t1:exon:1Medicago sativaexon
MSAD_210005.t1:exon:2MSAD_210005.t1:exon:2Medicago sativaexon
MSAD_210005.t1:exon:3MSAD_210005.t1:exon:3Medicago sativaexon


The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210005.t1:cdsMSAD_210005.t1:cdsMedicago sativaCDS


Synonyms
The feature 'MSAD_210005.t1' has the following synonyms
Synonym
maker-Scc4a34_6-augustus-gene-0.9-mRNA-1
Sequence

Variant Marked-up Sequence

>MSAD_210005.t1:1-500
        cagtaataattttggcttgtttaacccttgcagtggttgactcgacgacaagcacacttagtgcgtgcccaacagggtatccctctgtctgaatacgggattttggtcgatatgattcgcgtgcctgattgggcatttgaagctgcaggtcaagaaacaaggggcatgggccaagatactgcttcatatcatccaggactttacctaacaccggctcagagagaagcagtcgaagctttaattcaggaactcccaaagttcaggttgaaggctgttcctactgattgcagtgaatgccccatctgcttagaagagttccgtgttgggaatgaggttcgtggcttgccttgtgcacacaattttcatgttgaatgcattgacgagtggcttaggctgaatgtgaagtgtcctaggtgccgttgctcagtgtttccaaatcttgatcttagtgccctgtccaatctccgtcctgattctgaacgatcttctgccagtgttgt      

FASTA Record

The following sequence is that of the mRNA without any variants taken into account.

>MSAD_210005.t1:1-500
        cagtaataattttggcttgtttaacccttgcagtggttgactcgacgacaagcacacttagtgcgtgcccaacagggtatccctctgtctgaatacgggattttggtcgatatgattcgcgtgcctgattgggcatttgaagctgcaggtcaagaaacaaggggcatgggccaagatactgcttcatatcatccaggactttacctaacaccggctcagagagaagcagtcgaagctttaattcaggaactcccaaagttcaggttgaaggctgttcctactgattgcagtgaatgccccatctgcttagaagagttccgtgttgggaatgaggttcgtggcttgccttgtgcacacaattttcatgttgaatgcattgacgagtggcttaggctgaatgtgaagtgtcctaggtgccgttgctcagtgtttccaaatcttgatcttagtgccctgtccaatctccgtcctgattctgaacgatcttctgccagtgttgt