MSAD_210006.t1 (mRNA; Medicago sativa )

Overview
NameMSAD_210006.t1
Unique NameMSAD_210006.t1
TypemRNA
OrganismMedicago sativa (alfalfa)
Sequence length978
View on JBrowse
Gene Expression Atlas
Gene Ontology
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0010343 singlet oxygen-mediated programmed cell death
cellular_component GO:0042651 thylakoid membrane
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Scc4a34_6supercontigScc4a34_6:14857..16706 +
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Gene Ontology Update2017-11-12
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
Properties
Property NameValue
eAED0.45
QI0|0|0|0.57|0.5|0.42|7|0|326
AED0.36
NoteExecuter 1 putative MAKER:9.3:0.36:Medtr3g078020
Relationships

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
MSAD_210006MSAD_210006Medicago sativagene


The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210006.t1MSAD_210006.t1-proteinMedicago sativapolypeptide


The following exon feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210006.t1:exon:7MSAD_210006.t1:exon:7Medicago sativaexon
MSAD_210006.t1:exon:8MSAD_210006.t1:exon:8Medicago sativaexon
MSAD_210006.t1:exon:9MSAD_210006.t1:exon:9Medicago sativaexon
MSAD_210006.t1:exon:10MSAD_210006.t1:exon:10Medicago sativaexon
MSAD_210006.t1:exon:11MSAD_210006.t1:exon:11Medicago sativaexon
MSAD_210006.t1:exon:12MSAD_210006.t1:exon:12Medicago sativaexon
MSAD_210006.t1:exon:13MSAD_210006.t1:exon:13Medicago sativaexon


The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210006.t1:cdsMSAD_210006.t1:cdsMedicago sativaCDS


Synonyms
The feature 'MSAD_210006.t1' has the following synonyms
Synonym
maker-Scc4a34_6-snap-gene-0.12-mRNA-1
Sequence

Variant Marked-up Sequence

>MSAD_210006.t1:1-500
        tggcgtctctttcactgctcccaaactcagatgttttgacttttgaggcccactcaaccacaaacccaaacaaacacagtactagcatttactttcattctaagtacaaaaggaacagcaacacccttagttgccgttgcacttctcccatttcaaaatgcagagaccccacgcaacagttgctcaaaggattacctggtaccacagtatttgaaatttatgtggtagtgcatttgctacgagccaaaagaaattcaaagagcagtcctccatctaatgcgattaagagcccaaccaaatctgaggctgaaaaaaatgacgaggtgaacagttctattgaggaagcaactaaacaaggcattaaaagtgtactatattttcttaaggacaaaattccaggattgcaaattacaataatgaacataaacactgaagaggaaggggcagaagtggatgaatttattattccaccgatgcacgaagatagtaataaaactaca      

FASTA Record

The following sequence is that of the mRNA without any variants taken into account.

>MSAD_210006.t1:1-500
        tggcgtctctttcactgctcccaaactcagatgttttgacttttgaggcccactcaaccacaaacccaaacaaacacagtactagcatttactttcattctaagtacaaaaggaacagcaacacccttagttgccgttgcacttctcccatttcaaaatgcagagaccccacgcaacagttgctcaaaggattacctggtaccacagtatttgaaatttatgtggtagtgcatttgctacgagccaaaagaaattcaaagagcagtcctccatctaatgcgattaagagcccaaccaaatctgaggctgaaaaaaatgacgaggtgaacagttctattgaggaagcaactaaacaaggcattaaaagtgtactatattttcttaaggacaaaattccaggattgcaaattacaataatgaacataaacactgaagaggaaggggcagaagtggatgaatttattattccaccgatgcacgaagatagtaataaaactaca