MSAD_210007.t1 (mRNA; Medicago sativa )

Overview
NameMSAD_210007.t1
Unique NameMSAD_210007.t1
TypemRNA
OrganismMedicago sativa (alfalfa)
Sequence length339
View on JBrowse
Gene Expression Atlas
Gene Ontology
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
cellular_component GO:0016021 integral component of membrane
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Scc4a34_7supercontigScc4a34_7:14254..14592 +
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Gene Ontology Update2017-11-12
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
Properties
Property NameValue
eAED0.24
QI0|-1|0|1|-1|1|1|0|112
AED0.24
NoteReceptor-like protein MAKER:22.1:0.24:Medtr4g032320
Relationships

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
MSAD_210007MSAD_210007Medicago sativagene


The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210007.t1MSAD_210007.t1-proteinMedicago sativapolypeptide


The following exon feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210007.t1:exon:0MSAD_210007.t1:exon:0Medicago sativaexon


The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210007.t1:cdsMSAD_210007.t1:cdsMedicago sativaCDS


Synonyms
The feature 'MSAD_210007.t1' has the following synonyms
Synonym
augustus_masked-Scc4a34_7-processed-gene-0.0-mRNA-1
Sequence

Variant Marked-up Sequence

>MSAD_210007.t1:1-339
        ATGCCATCCTCACTTTCAAACCTTCAACATCTCATTCAGTTTGATCTTGCATCCAATTCATTTAGCGGTGAAATCCCAGATGTGTTTGGTGGGATGACAAAACTGCAAGAACTCTACTTAGATTCTAACAATTTAGAAGGACAAATTCCATCTTCACTATTCAACTTGTCTCAACTTGTTGGATTATTTTGTTCTGATAACAAATTAGAGGGTCCTCTGCCCAACCAAATTATAAGGTTCCAAAAGCTAACTGATTTGAGATTAAATGACAACTTGCTAAATGGTACAATTCCTACCTCTTTGAGATTCAATCAAGAAGGCATGTTTCTCTTTCTTTGA      

FASTA Record

The following sequence is that of the mRNA without any variants taken into account.

>MSAD_210007.t1:1-339
        ATGCCATCCTCACTTTCAAACCTTCAACATCTCATTCAGTTTGATCTTGCATCCAATTCATTTAGCGGTGAAATCCCAGATGTGTTTGGTGGGATGACAAAACTGCAAGAACTCTACTTAGATTCTAACAATTTAGAAGGACAAATTCCATCTTCACTATTCAACTTGTCTCAACTTGTTGGATTATTTTGTTCTGATAACAAATTAGAGGGTCCTCTGCCCAACCAAATTATAAGGTTCCAAAAGCTAACTGATTTGAGATTAAATGACAACTTGCTAAATGGTACAATTCCTACCTCTTTGAGATTCAATCAAGAAGGCATGTTTCTCTTTCTTTGA