MSAD_210008.t1 (mRNA; Medicago sativa )

Overview
NameMSAD_210008.t1
Unique NameMSAD_210008.t1
TypemRNA
OrganismMedicago sativa (alfalfa)
Sequence length234
View on JBrowse
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Scc4a34_7supercontigScc4a34_7:30296..30529 +
Properties
Property NameValue
eAED0.41
QI0|-1|0|1|-1|1|1|0|78
AED0.41
NoteReceptor-like protein MAKER:32.5:0.41:Medtr4g032320
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
Relationships

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
MSAD_210008MSAD_210008Medicago sativagene


The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210008.t1MSAD_210008.t1-proteinMedicago sativapolypeptide


The following exon feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210008.t1:exon:1MSAD_210008.t1:exon:1Medicago sativaexon


The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210008.t1:cdsMSAD_210008.t1:cdsMedicago sativaCDS


Synonyms
The feature 'MSAD_210008.t1' has the following synonyms
Synonym
snap_masked-Scc4a34_7-processed-gene-0.2-mRNA-1
Sequence

Variant Marked-up Sequence

>MSAD_210008.t1:1-234
        ATGCCATCCTCACTTTCAAACCTTCAACATCTCATTCAGTTTGATCTTGCATCCAATTCATTTAGCGGTGAAATCCCAGATGTGTTTGGTGGGATGACAAAACTGCAAGAACTCTACTTAGATTCTAACAATTTAGAAGGACAAATTCCATCTTCACTATTCAACTTGTCTCAACTTGTTGGATTATTTTGTTCTGATAACAAATTAGAGGGTCCTCTGCCCAACCAAATTATA      

FASTA Record

The following sequence is that of the mRNA without any variants taken into account.

>MSAD_210008.t1:1-234
        ATGCCATCCTCACTTTCAAACCTTCAACATCTCATTCAGTTTGATCTTGCATCCAATTCATTTAGCGGTGAAATCCCAGATGTGTTTGGTGGGATGACAAAACTGCAAGAACTCTACTTAGATTCTAACAATTTAGAAGGACAAATTCCATCTTCACTATTCAACTTGTCTCAACTTGTTGGATTATTTTGTTCTGATAACAAATTAGAGGGTCCTCTGCCCAACCAAATTATA