MSAD_210015.t1 (mRNA; Medicago sativa )

Overview
NameMSAD_210015.t1
Unique NameMSAD_210015.t1
TypemRNA
OrganismMedicago sativa (alfalfa)
Sequence length252
View on JBrowse
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Scc4a34_9supercontigScc4a34_9:3857..4189 +
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
Properties
Property NameValue
eAED0.51
QI0|0|0|1|0|0|2|0|83
AED0.47
NoteUncharacterized protein MAKER:0.0:0.47:Medtr2g084470
Relationships

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
MSAD_210015MSAD_210015Medicago sativagene


The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210015.t1MSAD_210015.t1-proteinMedicago sativapolypeptide


The following exon feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210015.t1:exon:11MSAD_210015.t1:exon:11Medicago sativaexon
MSAD_210015.t1:exon:12MSAD_210015.t1:exon:12Medicago sativaexon


The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210015.t1:cdsMSAD_210015.t1:cdsMedicago sativaCDS


Synonyms
The feature 'MSAD_210015.t1' has the following synonyms
Synonym
maker-Scc4a34_9-snap-gene-0.3-mRNA-1
Sequence

Variant Marked-up Sequence

>MSAD_210015.t1:1-252
        atggaagtcgtagatatgctcgttagatttcctaggaactattacatgcttcgattcgataaggctaggccactttatgccctttttagtgaaagaaaaaggtcaaaaacgatcgtagatatgctcgttagatttcctaggaactattacatgcttcgattcgataaggctaggccactttatgccctttttagtgaaagaaaaaggtcaaaaacgagtaaaatccgtaaattaacaaggaaattcacttaa      

FASTA Record

The following sequence is that of the mRNA without any variants taken into account.

>MSAD_210015.t1:1-252
        atggaagtcgtagatatgctcgttagatttcctaggaactattacatgcttcgattcgataaggctaggccactttatgccctttttagtgaaagaaaaaggtcaaaaacgatcgtagatatgctcgttagatttcctaggaactattacatgcttcgattcgataaggctaggccactttatgccctttttagtgaaagaaaaaggtcaaaaacgagtaaaatccgtaaattaacaaggaaattcacttaa