MSAD_210023.t1 (mRNA; Medicago sativa )

Overview
NameMSAD_210023.t1
Unique NameMSAD_210023.t1
TypemRNA
OrganismMedicago sativa (alfalfa)
Sequence length594
View on JBrowse
Gene Expression Atlas
Gene Ontology
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
cellular_component GO:0016021 integral component of membrane
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Scc4a34_10supercontigScc4a34_10:11798..14202 -
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Gene Ontology Update2017-11-12
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
Properties
Property NameValue
eAED0.41
QI0|0|0|0.5|1|1|6|0|197
AED0.37
NoteTransmembrane protein putative MAKER:33.0:0.37:Medtr8g099425
Relationships

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
MSAD_210023MSAD_210023Medicago sativagene


The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210023.t1MSAD_210023.t1-proteinMedicago sativapolypeptide


The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210023.t1:cdsMSAD_210023.t1:cdsMedicago sativaCDS


The following exon feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210023.t1:exon:2MSAD_210023.t1:exon:2Medicago sativaexon
MSAD_210023.t1:exon:3MSAD_210023.t1:exon:3Medicago sativaexon
MSAD_210023.t1:exon:4MSAD_210023.t1:exon:4Medicago sativaexon
MSAD_210023.t1:exon:5MSAD_210023.t1:exon:5Medicago sativaexon
MSAD_210023.t1:exon:6MSAD_210023.t1:exon:6Medicago sativaexon
MSAD_210023.t1:exon:7MSAD_210023.t1:exon:7Medicago sativaexon


Synonyms
The feature 'MSAD_210023.t1' has the following synonyms
Synonym
snap_masked-Scc4a34_10-processed-gene-0.5-mRNA-1
Sequence

Variant Marked-up Sequence

>MSAD_210023.t1:1-500
        tgaagatccaagcatctgatggtgtgtccggcttcacggcggcatcaccatcttcgttccaagctttggttcgtcgctctctgccgccatatgctcgttctgtcccgccgtcccttgaacccaccgtcgccaactgcggtctagtggtggttggctcggttctggttgctgtcgttgttgttgtctgtggtggttcggttggtcttgagaatggtagagaggttgtgacgctactgttgctggatagtgcttttgttttgccttctgctgtgttgtgcttatgttcgtttgttctggtgcttggtcctggttgttccgattctgacggctgcaagtgtggtgactttcctccacgattaatcctccctcgtcgtgctcccggatcgttcgtcgtcatttggatcgtggtggttctgtttgttcttgcaggtggttgtggtgggcgccggtggccttgtatcatcgtgtgttcgggggttgttggcacttggattggtttc      

FASTA Record

The following sequence is that of the mRNA without any variants taken into account.

>MSAD_210023.t1:1-500
        tgaagatccaagcatctgatggtgtgtccggcttcacggcggcatcaccatcttcgttccaagctttggttcgtcgctctctgccgccatatgctcgttctgtcccgccgtcccttgaacccaccgtcgccaactgcggtctagtggtggttggctcggttctggttgctgtcgttgttgttgtctgtggtggttcggttggtcttgagaatggtagagaggttgtgacgctactgttgctggatagtgcttttgttttgccttctgctgtgttgtgcttatgttcgtttgttctggtgcttggtcctggttgttccgattctgacggctgcaagtgtggtgactttcctccacgattaatcctccctcgtcgtgctcccggatcgttcgtcgtcatttggatcgtggtggttctgtttgttcttgcaggtggttgtggtgggcgccggtggccttgtatcatcgtgtgttcgggggttgttggcacttggattggtttc