MSAD_210025.t1 (mRNA; Medicago sativa )

Overview
NameMSAD_210025.t1
Unique NameMSAD_210025.t1
TypemRNA
OrganismMedicago sativa (alfalfa)
Sequence length486
View on JBrowse
Gene Expression Atlas
Gene Ontology
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0006629 lipid metabolic process
molecular_function GO:0080019 fatty-acyl-CoA reductase (alcohol-forming) activity
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Scc4a34_13supercontigScc4a34_13:782..4868 -
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Gene Ontology Update2017-11-12
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
Properties
Property NameValue
eAED0.24
QI0|0|0|1|0|0.5|4|0|162
AED0.24
NoteFatty acyl-CoA reductase MAKER:8.5:0.24:Medtr6g034660
Relationships

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
MSAD_210025MSAD_210025Medicago sativagene


The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210025.t1MSAD_210025.t1-proteinMedicago sativapolypeptide


The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210025.t1:cdsMSAD_210025.t1:cdsMedicago sativaCDS


The following exon feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210025.t1:exon:26MSAD_210025.t1:exon:26Medicago sativaexon
MSAD_210025.t1:exon:27MSAD_210025.t1:exon:27Medicago sativaexon
MSAD_210025.t1:exon:28MSAD_210025.t1:exon:28Medicago sativaexon
MSAD_210025.t1:exon:29MSAD_210025.t1:exon:29Medicago sativaexon


Synonyms
The feature 'MSAD_210025.t1' has the following synonyms
Synonym
maker-Scc4a34_13-snap-gene-0.58-mRNA-1
Sequence

Variant Marked-up Sequence

>MSAD_210025.t1:1-486
        ATGGAATTCGGAGATGTTCGTGAATTTTTTGCAGGAAAGACCATTTTGGTTACTGGTGGAACGGGATTCATAGGAAAAGTTTTTGTGGAGAAGATATTAAGGGTTCAACCGGACATAAAAAAGTTATACCTTCTTATTAGATCACGAAATACTTGTTTAGCTACACAACGCTTGCAAGTTGAGACTTGCCCGCCAAAATTGGCACCAGAGGGAATCGAACCTGAGACCGGAGTACACTCCAAGATCCCAAACCAACCACTAGGTCAACCCCAAATGGGTTTATCGCTGCACTTGAAAGAATTGTTCAAGGTGCAAAGAGCTGAAAAGGGTGCAGATTTTGACTCTTTTATATCCGAGAAAGTGGTTGCTGTTGTCGGTGATGTAACTCTAGAAATGTTGGGAGTGAAAGATGTGAAAAGGAATGAGGAGATGTTGAAAGAGATTGATATAATAATTCATTCTGCTTCCATAACCACGTTTAATGAG      

FASTA Record

The following sequence is that of the mRNA without any variants taken into account.

>MSAD_210025.t1:1-486
        ATGGAATTCGGAGATGTTCGTGAATTTTTTGCAGGAAAGACCATTTTGGTTACTGGTGGAACGGGATTCATAGGAAAAGTTTTTGTGGAGAAGATATTAAGGGTTCAACCGGACATAAAAAAGTTATACCTTCTTATTAGATCACGAAATACTTGTTTAGCTACACAACGCTTGCAAGTTGAGACTTGCCCGCCAAAATTGGCACCAGAGGGAATCGAACCTGAGACCGGAGTACACTCCAAGATCCCAAACCAACCACTAGGTCAACCCCAAATGGGTTTATCGCTGCACTTGAAAGAATTGTTCAAGGTGCAAAGAGCTGAAAAGGGTGCAGATTTTGACTCTTTTATATCCGAGAAAGTGGTTGCTGTTGTCGGTGATGTAACTCTAGAAATGTTGGGAGTGAAAGATGTGAAAAGGAATGAGGAGATGTTGAAAGAGATTGATATAATAATTCATTCTGCTTCCATAACCACGTTTAATGAG