MSAD_210026.t1 (mRNA; Medicago sativa )

Overview
NameMSAD_210026.t1
Unique NameMSAD_210026.t1
TypemRNA
OrganismMedicago sativa (alfalfa)
Sequence length300
View on JBrowse
Gene Expression Atlas
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Scc4a34_13supercontigScc4a34_13:10100..11088 -
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
Properties
Property NameValue
eAED1.00
QI0|0|0|0.33|0|0.33|3|0|99
AED0.59
NoteUncharacterized protein MAKER:25.8:0.59:
Relationships

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
MSAD_210026MSAD_210026Medicago sativagene


The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210026.t1MSAD_210026.t1-proteinMedicago sativapolypeptide


The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210026.t1:cdsMSAD_210026.t1:cdsMedicago sativaCDS


The following exon feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210026.t1:exon:50MSAD_210026.t1:exon:50Medicago sativaexon
MSAD_210026.t1:exon:51MSAD_210026.t1:exon:51Medicago sativaexon
MSAD_210026.t1:exon:52MSAD_210026.t1:exon:52Medicago sativaexon


Synonyms
The feature 'MSAD_210026.t1' has the following synonyms
Synonym
maker-Scc4a34_13-augustus-gene-0.48-mRNA-1
Sequence

Variant Marked-up Sequence

>MSAD_210026.t1:1-300
        ATGAATGGTATTTACTATTTAGTTCCAACATCTGTTAGTAGCCCAACCCTTGGTGATTTCCTGTTCGACATTGAAACTACTGTGGATCTTGATTGGGGTAGCAGTAATAACCCTAATGATAGTAATAGTTTCGAGGGAAAGTCCAGAATGGATGAGCAAATTCAACTTTTCTCCTGGGAACTTCTCTCCATGGGTCTTGGCTTGCGTAGTTATTGTCTTCACCCGCATGAGAAAGAGAACAAAGGATTTTCTAACAAAGCGCGGTTGGTGAATCGACTCGTGTTGATGCTTTTGTCGTAG      

FASTA Record

The following sequence is that of the mRNA without any variants taken into account.

>MSAD_210026.t1:1-300
        ATGAATGGTATTTACTATTTAGTTCCAACATCTGTTAGTAGCCCAACCCTTGGTGATTTCCTGTTCGACATTGAAACTACTGTGGATCTTGATTGGGGTAGCAGTAATAACCCTAATGATAGTAATAGTTTCGAGGGAAAGTCCAGAATGGATGAGCAAATTCAACTTTTCTCCTGGGAACTTCTCTCCATGGGTCTTGGCTTGCGTAGTTATTGTCTTCACCCGCATGAGAAAGAGAACAAAGGATTTTCTAACAAAGCGCGGTTGGTGAATCGACTCGTGTTGATGCTTTTGTCGTAG