MSAD_210027.t1 (mRNA; Medicago sativa )

Overview
NameMSAD_210027.t1
Unique NameMSAD_210027.t1
TypemRNA
OrganismMedicago sativa (alfalfa)
Sequence length540
View on JBrowse
Gene Expression Atlas
Gene Ontology
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
molecular_function GO:0004857 enzyme inhibitor activity
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Scc4a34_13supercontigScc4a34_13:20764..21303 -
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Gene Ontology Update2017-11-12
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
Properties
Property NameValue
eAED0.37
QI0|-1|0|1|-1|1|1|0|179
AED0.37
NotePlant invertase/pectin methylesterase inhibitor protein MAKER:6.1:0.37:Medtr6g034800
Relationships

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
MSAD_210027MSAD_210027Medicago sativagene


The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210027.t1MSAD_210027.t1-proteinMedicago sativapolypeptide


The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210027.t1:cdsMSAD_210027.t1:cdsMedicago sativaCDS


The following exon feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210027.t1:exon:39MSAD_210027.t1:exon:39Medicago sativaexon


Synonyms
The feature 'MSAD_210027.t1' has the following synonyms
Synonym
augustus_masked-Scc4a34_13-processed-gene-0.4-mRNA-1
Sequence

Variant Marked-up Sequence

>MSAD_210027.t1:1-500
        TGAAATCCACAACACAAACATCATTGTTCATTTTCTTCTTGTGCATCATATTTTATGCTCCTCTTCCAGCAATATCAGTCAGCTTGTATGAATCTTTATGCAATGAGTACAGCAACCCTAGCAGCAATATCAAATTATGCTTGAATATATTGAAAACTGACCCAGAAATCACCTCAGCCACAAATTACCATGACCTCTCCTTGTATATCTTGGAGATGGTTCAAAAAGACGCAGCAGCGGTTCAACTTGATCTTTTTGAAAAGAGAAAACTTTTTCCCACTGATCCAGCTCTTAACAGTTGTGTTAATGAATTCTATGAAACAACTATTAATGAATTACAAAAGGCATTGCGTTTGTTGCCAACTGATCCTCAAACTGCAAGAGATAGTGCAATAGCTGCTGGTTTTGGAGCTAATAATTGCGAGAAAGCTTTTGAAAAACCAGAGGAAAAGAATGTTCGTGCTGCAATCCATCTTCGAAACAATGATATCTTTTTTCGA      

FASTA Record

The following sequence is that of the mRNA without any variants taken into account.

>MSAD_210027.t1:1-500
        TGAAATCCACAACACAAACATCATTGTTCATTTTCTTCTTGTGCATCATATTTTATGCTCCTCTTCCAGCAATATCAGTCAGCTTGTATGAATCTTTATGCAATGAGTACAGCAACCCTAGCAGCAATATCAAATTATGCTTGAATATATTGAAAACTGACCCAGAAATCACCTCAGCCACAAATTACCATGACCTCTCCTTGTATATCTTGGAGATGGTTCAAAAAGACGCAGCAGCGGTTCAACTTGATCTTTTTGAAAAGAGAAAACTTTTTCCCACTGATCCAGCTCTTAACAGTTGTGTTAATGAATTCTATGAAACAACTATTAATGAATTACAAAAGGCATTGCGTTTGTTGCCAACTGATCCTCAAACTGCAAGAGATAGTGCAATAGCTGCTGGTTTTGGAGCTAATAATTGCGAGAAAGCTTTTGAAAAACCAGAGGAAAAGAATGTTCGTGCTGCAATCCATCTTCGAAACAATGATATCTTTTTTCGA