MSAD_210062.t1 (mRNA; Medicago sativa )

Overview
NameMSAD_210062.t1
Unique NameMSAD_210062.t1
TypemRNA
OrganismMedicago sativa (alfalfa)
Sequence length318
View on JBrowse
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Scc4a34_22supercontigScc4a34_22:1251..1741 +
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
Properties
Property NameValue
eAED0.06
QI0|0|0|1|0|0|3|0|105
AED0.06
NoteUncharacterized protein MAKER:0.0:0.06:Medtr2g084470
Relationships

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
MSAD_210062MSAD_210062Medicago sativagene


The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210062.t1MSAD_210062.t1-proteinMedicago sativapolypeptide


The following exon feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210062.t1:exon:0MSAD_210062.t1:exon:0Medicago sativaexon
MSAD_210062.t1:exon:1MSAD_210062.t1:exon:1Medicago sativaexon
MSAD_210062.t1:exon:2MSAD_210062.t1:exon:2Medicago sativaexon


The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210062.t1:cdsMSAD_210062.t1:cdsMedicago sativaCDS


Synonyms
The feature 'MSAD_210062.t1' has the following synonyms
Synonym
maker-Scc4a34_22-snap-gene-0.2-mRNA-1
Sequence

Variant Marked-up Sequence

>MSAD_210062.t1:1-318
        ATGGAAGTCGTAGTTATGTTGTTTACCTATCCAACGAATTGTCACATGCTAAGATTCAATCCAAATCGGCCACTTTATGGCCTTCCTAGTAAAAAAGGGTCGAAAACGATTATGTTGTTTACCTATCCAACGAATTGTCACACGCTAAGATTCAATGCAAATCGGCCACATTATGGCCTTCCTAGTAAAAATGGGTCGAAAACGATTATGTTGTTTACCTATCCAACGAATTGTCACACGCTAAGATTCAATCAAATCGGCCACATTTATGGCCTTCCTAGTAAAAAAGGGTCGAAAACGAGTAATGTCCCAAATTAA      

FASTA Record

The following sequence is that of the mRNA without any variants taken into account.

>MSAD_210062.t1:1-318
        ATGGAAGTCGTAGTTATGTTGTTTACCTATCCAACGAATTGTCACATGCTAAGATTCAATCCAAATCGGCCACTTTATGGCCTTCCTAGTAAAAAAGGGTCGAAAACGATTATGTTGTTTACCTATCCAACGAATTGTCACACGCTAAGATTCAATGCAAATCGGCCACATTATGGCCTTCCTAGTAAAAATGGGTCGAAAACGATTATGTTGTTTACCTATCCAACGAATTGTCACACGCTAAGATTCAATCAAATCGGCCACATTTATGGCCTTCCTAGTAAAAAAGGGTCGAAAACGAGTAATGTCCCAAATTAA