MSAD_210066.t1 (mRNA; Medicago sativa )

Overview
NameMSAD_210066.t1
Unique NameMSAD_210066.t1
TypemRNA
OrganismMedicago sativa (alfalfa)
Sequence length2274
View on JBrowse
Gene Expression Atlas
Gene Ontology
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0006979 response to oxidative stress
cellular_component GO:0016020 membrane
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Scc4a34_26supercontigScc4a34_26:41933..45595 +
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Gene Ontology Update2017-11-12
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
Properties
Property NameValue
eAED0.01
QI1161|1|1|1|1|1|3|285|275
AED0.01
NoteTPR repeat protein MAKER:64.5:0.01:Medtr2g103795
Relationships

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
MSAD_210066MSAD_210066Medicago sativagene


The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210066.t1MSAD_210066.t1-proteinMedicago sativapolypeptide


The following exon feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210066.t1:exon:0MSAD_210066.t1:exon:0Medicago sativaexon
MSAD_210066.t1:exon:1MSAD_210066.t1:exon:1Medicago sativaexon
MSAD_210066.t1:exon:2MSAD_210066.t1:exon:2Medicago sativaexon


The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210066.t1:cdsMSAD_210066.t1:cdsMedicago sativaCDS


Synonyms
The feature 'MSAD_210066.t1' has the following synonyms
Synonym
maker-Scc4a34_26-augustus-gene-0.19-mRNA-1
Sequence

Variant Marked-up Sequence

>MSAD_210066.t1:1-500
        ATTTTTCAAAACCATTTTCAAAACACAAAATCCCTAAATTACAACCCTCAAACCCACAAATTGAAGGAAAAATTTGAGATAGATCTCACCTTCAACAAAGATGGAGAATCAGCAATAGAGGCAGTCCGACCATAGAGAGTGGTAAATCTGTAGATGCAGTCCAGCAATGAGCCCAACACAATAAAAAAACGTGTGAGCAAATCAAAGGGAGCAACTCCTAATTTATTGTCGCAAACTTCATTTCACTCATCTGAAAATCCAAACAAACTCTCTTCTTCTTTTTTGCTCAGATTCGAACAATACATATGAAAATTGAGATCTTGTTGATGATTGTGTTTCTAGTTAAAATCTATGTTTTGTTTTGCTGATTTTGAATGTTGTGTTTTCTGGGTTCTGATGGGGACGATGGGACACAATTGTAAGAATGACGGTGGTGTCAGATATGAGGCGGCGATGGTGGTGGTGGTGAGAGTGTGTGACGGTCGTCGGCCGTCGAGAAT      

FASTA Record

The following sequence is that of the mRNA without any variants taken into account.

>MSAD_210066.t1:1-500
        ATTTTTCAAAACCATTTTCAAAACACAAAATCCCTAAATTACAACCCTCAAACCCACAAATTGAAGGAAAAATTTGAGATAGATCTCACCTTCAACAAAGATGGAGAATCAGCAATAGAGGCAGTCCGACCATAGAGAGTGGTAAATCTGTAGATGCAGTCCAGCAATGAGCCCAACACAATAAAAAAACGTGTGAGCAAATCAAAGGGAGCAACTCCTAATTTATTGTCGCAAACTTCATTTCACTCATCTGAAAATCCAAACAAACTCTCTTCTTCTTTTTTGCTCAGATTCGAACAATACATATGAAAATTGAGATCTTGTTGATGATTGTGTTTCTAGTTAAAATCTATGTTTTGTTTTGCTGATTTTGAATGTTGTGTTTTCTGGGTTCTGATGGGGACGATGGGACACAATTGTAAGAATGACGGTGGTGTCAGATATGAGGCGGCGATGGTGGTGGTGGTGAGAGTGTGTGACGGTCGTCGGCCGTCGAGAAT