MSAD_210074.t1 (mRNA; Medicago sativa )

Overview
NameMSAD_210074.t1
Unique NameMSAD_210074.t1
TypemRNA
OrganismMedicago sativa (alfalfa)
Sequence length789
View on JBrowse
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Scc4a34_26supercontigScc4a34_26:120019..121725 -
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
Properties
Property NameValue
eAED0.38
QI0|0|0|0.75|1|1|4|0|262
AED0.38
NoteNon-specific serine/threonine protein kinase MAKER:10.0:0.38:Medtr5g021670
Relationships

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
MSAD_210074MSAD_210074Medicago sativagene


The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210074.t1MSAD_210074.t1-proteinMedicago sativapolypeptide


The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210074.t1:cdsMSAD_210074.t1:cdsMedicago sativaCDS


The following exon feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210074.t1:exon:72MSAD_210074.t1:exon:72Medicago sativaexon
MSAD_210074.t1:exon:73MSAD_210074.t1:exon:73Medicago sativaexon
MSAD_210074.t1:exon:74MSAD_210074.t1:exon:74Medicago sativaexon
MSAD_210074.t1:exon:75MSAD_210074.t1:exon:75Medicago sativaexon


Synonyms
The feature 'MSAD_210074.t1' has the following synonyms
Synonym
augustus_masked-Scc4a34_26-processed-gene-1.7-mRNA-1
Sequence

Variant Marked-up Sequence

>MSAD_210074.t1:1-500
        TGGGTTTGCAGGAGGATTTTGAGCAGCATGCCGCCAAAGTCAAGACTCTGACAGAGAGCCCATCAAATGAGGATTTTCTTATCCTTTATGGATTGTACAAGCAAGCCACTGTTGGAAATGTTGACACCGCAAATTCACTTTCTGGAGTGATTCCGTTGGCGATTTCGGCGCTTCCGATGCTTCAGGTGATGTCACTTTCTCACAATAATCTTACTGGATCAATTCCTGCTTCGGTTTTTTGCAATGTTTTGTTCCACGCGCCGTCTTTGACGATAGTTCAGCTTGGATTCAATGGTTTCACGGATTTCGTTGGATTTGAAACCAACACGTGTTTCAGTGTTGTTCAGTGCTTGATCTTTCGAGTAATGCATTTTTCGGCCGGGTTGACGGAGTTGAAGGTGGCTAATAATTCATTCACTGGTGTTATTCCTGTGGAAATAATGAAATGTAGGTCCCTTAGTGTTGTTGATTTTGAAGGAAACAATTTTGCCGGTGAAGTT      

FASTA Record

The following sequence is that of the mRNA without any variants taken into account.

>MSAD_210074.t1:1-500
        TGGGTTTGCAGGAGGATTTTGAGCAGCATGCCGCCAAAGTCAAGACTCTGACAGAGAGCCCATCAAATGAGGATTTTCTTATCCTTTATGGATTGTACAAGCAAGCCACTGTTGGAAATGTTGACACCGCAAATTCACTTTCTGGAGTGATTCCGTTGGCGATTTCGGCGCTTCCGATGCTTCAGGTGATGTCACTTTCTCACAATAATCTTACTGGATCAATTCCTGCTTCGGTTTTTTGCAATGTTTTGTTCCACGCGCCGTCTTTGACGATAGTTCAGCTTGGATTCAATGGTTTCACGGATTTCGTTGGATTTGAAACCAACACGTGTTTCAGTGTTGTTCAGTGCTTGATCTTTCGAGTAATGCATTTTTCGGCCGGGTTGACGGAGTTGAAGGTGGCTAATAATTCATTCACTGGTGTTATTCCTGTGGAAATAATGAAATGTAGGTCCCTTAGTGTTGTTGATTTTGAAGGAAACAATTTTGCCGGTGAAGTT