MSAD_210075.t1 (mRNA; Medicago sativa )

Overview
NameMSAD_210075.t1
Unique NameMSAD_210075.t1
TypemRNA
OrganismMedicago sativa (alfalfa)
Sequence length1530
View on JBrowse
Gene Expression Atlas
Gene Ontology
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
cellular_component GO:0016021 integral component of membrane
molecular_function GO:0016740 transferase activity
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Scc4a34_26supercontigScc4a34_26:124809..126914 -
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Gene Ontology Update2017-11-12
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
Properties
Property NameValue
eAED0.26
QI0|0|0|0.5|0|0|2|0|509
AED0.26
NoteTOO MANY mouths protein MAKER:8.8:0.26:Medtr2g103940
Relationships

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
MSAD_210075MSAD_210075Medicago sativagene


The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210075.t1MSAD_210075.t1-proteinMedicago sativapolypeptide


The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210075.t1:cdsMSAD_210075.t1:cdsMedicago sativaCDS


The following exon feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210075.t1:exon:82MSAD_210075.t1:exon:82Medicago sativaexon
MSAD_210075.t1:exon:83MSAD_210075.t1:exon:83Medicago sativaexon


Synonyms
The feature 'MSAD_210075.t1' has the following synonyms
Synonym
maker-Scc4a34_26-snap-gene-1.44-mRNA-1
Sequence

Variant Marked-up Sequence

>MSAD_210075.t1:1-500
        TGACTCGTAGCAATTGTCCCCTTACTCTATATCTGAATCAACATCAACAACTACTAGTAGTATGTTTCACTATATTGTTGTTTTTGTCGGATTTAGTAATGCCTTTCACGGTTGAAATTTCTGATTCCAATAGCTCCACCGTGCCTTCAGGTTCCACACCACTAATAGATGGCATTTCAACTAAACAAGATAATGCAAGAACCGATCCCCGCGAACAACATGCAGTTTACGACATCATGAAAGCCACGGGCAACGACTGGGCCACTGATATCCCTGACGTTTGTCGCGGTCGGTGGCATGGCATCGAATGCATGCCCGATAAAGACAATGTGTACCACATTGTCTCCCTCTCCTTCGGTGCTCTCTCAGACGACACGGCTTTTCCCACGTGCGATCCCACGAGTTCCACCATTTCACCCTCCATCCTAAACCTCCCTCATCTCAAAACCCTCTTCTTTTACCGTTGTTTTAGTTACAATCCTCATCCTATACCATCTTTC      

FASTA Record

The following sequence is that of the mRNA without any variants taken into account.

>MSAD_210075.t1:1-500
        TGACTCGTAGCAATTGTCCCCTTACTCTATATCTGAATCAACATCAACAACTACTAGTAGTATGTTTCACTATATTGTTGTTTTTGTCGGATTTAGTAATGCCTTTCACGGTTGAAATTTCTGATTCCAATAGCTCCACCGTGCCTTCAGGTTCCACACCACTAATAGATGGCATTTCAACTAAACAAGATAATGCAAGAACCGATCCCCGCGAACAACATGCAGTTTACGACATCATGAAAGCCACGGGCAACGACTGGGCCACTGATATCCCTGACGTTTGTCGCGGTCGGTGGCATGGCATCGAATGCATGCCCGATAAAGACAATGTGTACCACATTGTCTCCCTCTCCTTCGGTGCTCTCTCAGACGACACGGCTTTTCCCACGTGCGATCCCACGAGTTCCACCATTTCACCCTCCATCCTAAACCTCCCTCATCTCAAAACCCTCTTCTTTTACCGTTGTTTTAGTTACAATCCTCATCCTATACCATCTTTC