MSAD_210076.t1 (mRNA; Medicago sativa )

Overview
NameMSAD_210076.t1
Unique NameMSAD_210076.t1
TypemRNA
OrganismMedicago sativa (alfalfa)
Sequence length1244
View on JBrowse
Gene Expression Atlas
Gene Ontology
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
molecular_function GO:0016301 kinase activity
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Scc4a34_26supercontigScc4a34_26:129392..131746 +
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Gene Ontology Update2017-11-12
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
Properties
Property NameValue
eAED0.06
QI59|0.5|0.33|1|1|1|3|0|394
AED0.06
NoteAMP-activated kinase gamma regulatory subunit putative MAKER:7.1:0.06:Medtr2g103910
Relationships

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
MSAD_210076MSAD_210076Medicago sativagene


The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210076.t1MSAD_210076.t1-proteinMedicago sativapolypeptide


The following exon feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210076.t1:exon:18MSAD_210076.t1:exon:18Medicago sativaexon
MSAD_210076.t1:exon:19MSAD_210076.t1:exon:19Medicago sativaexon
MSAD_210076.t1:exon:20MSAD_210076.t1:exon:20Medicago sativaexon


The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210076.t1:cdsMSAD_210076.t1:cdsMedicago sativaCDS


Synonyms
The feature 'MSAD_210076.t1' has the following synonyms
Synonym
maker-Scc4a34_26-augustus-gene-1.33-mRNA-1
Sequence

Variant Marked-up Sequence

>MSAD_210076.t1:1-500
        AGCAACAACATATCCTATCATATCCTATTTTTCGTATATATTATATCTTTGATGCCTCATGCTAGCTAGCTCTATATTTTCCCACAATAGTAACAACATTTCTATTTCTATCAAGACCAATCTATTAGTTTTACGTAATAAGCCAAGAAAAATCGTAAACATGCAGAATCAAATGCAACACAGCGAGAGTATGAATCTAAAGGAGAAGAAAGTGAAGGATTTAATGGTGAATAAGAAAAGACTAGTGGAAGTACCATACACAGCTTCACTTGCACAAACAATGAACACACTTGTAGCAAACAAGGTAGTGGCGGTTCCGGTGGCTGCTCCGCCAGGTCAGTGGATAGGAGCAGGAGGGTCTATGATTGTGGAGTCTGATAAACAAACAGGAGCTGTAAGGAAGCATTATATAGGGATGGTTACTATGCTTGATATTGTTGCTCATATAGCTGGTGATGATCATTTGAGTGGTGGTGATGATGTTGAAGAAGATCTTGATC      

FASTA Record

The following sequence is that of the mRNA without any variants taken into account.

>MSAD_210076.t1:1-500
        AGCAACAACATATCCTATCATATCCTATTTTTCGTATATATTATATCTTTGATGCCTCATGCTAGCTAGCTCTATATTTTCCCACAATAGTAACAACATTTCTATTTCTATCAAGACCAATCTATTAGTTTTACGTAATAAGCCAAGAAAAATCGTAAACATGCAGAATCAAATGCAACACAGCGAGAGTATGAATCTAAAGGAGAAGAAAGTGAAGGATTTAATGGTGAATAAGAAAAGACTAGTGGAAGTACCATACACAGCTTCACTTGCACAAACAATGAACACACTTGTAGCAAACAAGGTAGTGGCGGTTCCGGTGGCTGCTCCGCCAGGTCAGTGGATAGGAGCAGGAGGGTCTATGATTGTGGAGTCTGATAAACAAACAGGAGCTGTAAGGAAGCATTATATAGGGATGGTTACTATGCTTGATATTGTTGCTCATATAGCTGGTGATGATCATTTGAGTGGTGGTGATGATGTTGAAGAAGATCTTGATC