MSAD_210093.t1 (mRNA; Medicago sativa )

Overview
NameMSAD_210093.t1
Unique NameMSAD_210093.t1
TypemRNA
OrganismMedicago sativa (alfalfa)
Sequence length1038
View on JBrowse
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Scc4a34_26supercontigScc4a34_26:293410..298694 -
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
Properties
Property NameValue
eAED0.27
QI0|0|0|0.25|0.71|0.75|8|0|346
AED0.27
NotePolynucleotidyl transferase Ribonuclease H fold MAKER:7.4:0.27:Medtr8g028785
Relationships

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
MSAD_210093MSAD_210093Medicago sativagene


The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210093.t1MSAD_210093.t1-proteinMedicago sativapolypeptide


The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210093.t1:cdsMSAD_210093.t1:cdsMedicago sativaCDS


The following exon feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210093.t1:exon:160MSAD_210093.t1:exon:160Medicago sativaexon
MSAD_210093.t1:exon:161MSAD_210093.t1:exon:161Medicago sativaexon
MSAD_210093.t1:exon:162MSAD_210093.t1:exon:162Medicago sativaexon
MSAD_210093.t1:exon:163MSAD_210093.t1:exon:163Medicago sativaexon
MSAD_210093.t1:exon:164MSAD_210093.t1:exon:164Medicago sativaexon
MSAD_210093.t1:exon:165MSAD_210093.t1:exon:165Medicago sativaexon
MSAD_210093.t1:exon:166MSAD_210093.t1:exon:166Medicago sativaexon
MSAD_210093.t1:exon:167MSAD_210093.t1:exon:167Medicago sativaexon


Synonyms
The feature 'MSAD_210093.t1' has the following synonyms
Synonym
maker-Scc4a34_26-snap-gene-3.52-mRNA-1
Sequence

Variant Marked-up Sequence

>MSAD_210093.t1:1-500
        TGGTGCTCATAGATGATGGAGTTTGCAGAAGAATTGTGCTGAAGAATAAAAAGAGGATGGAGTTTGGAAGAGAGAGGGTTAATCTGGAAAGAGAAGTCGTCAAAAAGTCAATTGTGCTCATGATCGTCACAGAAGGATGTAGAAGTCCAGAAGCTGTTGAGTTTCTTAAGGAAGTTGCTGATGAATTGGATGAGCAAATGTTGAAGTTTCAAAATATGCAAATAAGTAGTGAACAAGTGAATGGAACCTCTAACAATATTAAAGAGATATCATGTACTAATGATGGTGCAACACAAGTAAAGGGGTTTAAGAACAAAGAAGGTCCAAAGGGTTCAAAACGTTGGAAAGGTTGGGTAGAAACAAAATTGGCCAAGAGAAAGAAACGCGCAAAGTCCACTGCTTCACAAATTCAAGAACCTATGAAGAACAAAGCTAAGCAGGTTTCCAAAAATGTAATGAGGCGGGATGAAGTGTCAAACACAAGTGCTTCACAAAGTCAA      

FASTA Record

The following sequence is that of the mRNA without any variants taken into account.

>MSAD_210093.t1:1-500
        TGGTGCTCATAGATGATGGAGTTTGCAGAAGAATTGTGCTGAAGAATAAAAAGAGGATGGAGTTTGGAAGAGAGAGGGTTAATCTGGAAAGAGAAGTCGTCAAAAAGTCAATTGTGCTCATGATCGTCACAGAAGGATGTAGAAGTCCAGAAGCTGTTGAGTTTCTTAAGGAAGTTGCTGATGAATTGGATGAGCAAATGTTGAAGTTTCAAAATATGCAAATAAGTAGTGAACAAGTGAATGGAACCTCTAACAATATTAAAGAGATATCATGTACTAATGATGGTGCAACACAAGTAAAGGGGTTTAAGAACAAAGAAGGTCCAAAGGGTTCAAAACGTTGGAAAGGTTGGGTAGAAACAAAATTGGCCAAGAGAAAGAAACGCGCAAAGTCCACTGCTTCACAAATTCAAGAACCTATGAAGAACAAAGCTAAGCAGGTTTCCAAAAATGTAATGAGGCGGGATGAAGTGTCAAACACAAGTGCTTCACAAAGTCAA