MSAD_210094.t1 (mRNA; Medicago sativa )

Overview
NameMSAD_210094.t1
Unique NameMSAD_210094.t1
TypemRNA
OrganismMedicago sativa (alfalfa)
Sequence length3932
View on JBrowse
Gene Expression Atlas
Gene Ontology
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0016042 lipid catabolic process
biological_process GO:0046470 phosphatidylcholine metabolic process
cellular_component GO:0016020 membrane
molecular_function GO:0005509 calcium ion binding
molecular_function GO:0070290 N-acylphosphatidylethanolamine-specific phospholipase D activity
molecular_function GO:0004630 phospholipase D activity
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Scc4a34_26supercontigScc4a34_26:300240..310763 -
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Gene Ontology Update2017-11-12
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
Properties
Property NameValue
eAED0.07
QI107|0.55|0.5|1|0.66|0.6|10|939|961
AED0.07
NotePhospholipase D MAKER:161.4:0.07:Medtr2g103730
Relationships

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
MSAD_210094MSAD_210094Medicago sativagene


The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210094.t1MSAD_210094.t1-proteinMedicago sativapolypeptide


The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210094.t1:cdsMSAD_210094.t1:cdsMedicago sativaCDS


The following exon feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210094.t1:exon:142MSAD_210094.t1:exon:142Medicago sativaexon
MSAD_210094.t1:exon:143MSAD_210094.t1:exon:143Medicago sativaexon
MSAD_210094.t1:exon:144MSAD_210094.t1:exon:144Medicago sativaexon
MSAD_210094.t1:exon:145MSAD_210094.t1:exon:145Medicago sativaexon
MSAD_210094.t1:exon:146MSAD_210094.t1:exon:146Medicago sativaexon
MSAD_210094.t1:exon:147MSAD_210094.t1:exon:147Medicago sativaexon
MSAD_210094.t1:exon:148MSAD_210094.t1:exon:148Medicago sativaexon
MSAD_210094.t1:exon:149MSAD_210094.t1:exon:149Medicago sativaexon
MSAD_210094.t1:exon:150MSAD_210094.t1:exon:150Medicago sativaexon
MSAD_210094.t1:exon:151MSAD_210094.t1:exon:151Medicago sativaexon


Synonyms
The feature 'MSAD_210094.t1' has the following synonyms
Synonym
maker-Scc4a34_26-snap-gene-3.54-mRNA-1
Sequence

Variant Marked-up Sequence

>MSAD_210094.t1:1-500
        TGAATAAATAAACTCCTACTATATCTCGGTTCTATTCCTTTTCCCATTCATCATTCACCAACTACTCTCATTTTCATCTCTGAACTGAACTCTACACAAGTAATTGATGGCGCAAATTCTGCTACATGGAACTCTTCATGCTACAATCTTTGAGGTCGATAAACTCAAGAATATTAGTGGTGGTAACATTCTTTCCAAGATAAGACAAAACTTTGAGGAGACAGTTGGATTCGGAAAAGGAACTACCAAACTTTATGCAACCATTGATTTAGAGAAAGCACGAGTGGGAAGGACCAGAATCATAGAAAAGGAGCATGTTAATCCTCAATGGAATGAGTCTTTTCACATTTACTGTGCCCATTTGGCATCGGATATCATATTCACTGTGAAAGATGATAATCCTATTGGGGCAACCTTAATTGGAAGGGCGTACATTCCTGTTGAGGAGGTATTGGGTGGTGAGGAAATAGATAGGTGGGTTGAAATATTGGATGTGAATA      

FASTA Record

The following sequence is that of the mRNA without any variants taken into account.

>MSAD_210094.t1:1-500
        TGAATAAATAAACTCCTACTATATCTCGGTTCTATTCCTTTTCCCATTCATCATTCACCAACTACTCTCATTTTCATCTCTGAACTGAACTCTACACAAGTAATTGATGGCGCAAATTCTGCTACATGGAACTCTTCATGCTACAATCTTTGAGGTCGATAAACTCAAGAATATTAGTGGTGGTAACATTCTTTCCAAGATAAGACAAAACTTTGAGGAGACAGTTGGATTCGGAAAAGGAACTACCAAACTTTATGCAACCATTGATTTAGAGAAAGCACGAGTGGGAAGGACCAGAATCATAGAAAAGGAGCATGTTAATCCTCAATGGAATGAGTCTTTTCACATTTACTGTGCCCATTTGGCATCGGATATCATATTCACTGTGAAAGATGATAATCCTATTGGGGCAACCTTAATTGGAAGGGCGTACATTCCTGTTGAGGAGGTATTGGGTGGTGAGGAAATAGATAGGTGGGTTGAAATATTGGATGTGAATA