MSAD_210110.t1 (mRNA; Medicago sativa )

Overview
NameMSAD_210110.t1
Unique NameMSAD_210110.t1
TypemRNA
OrganismMedicago sativa (alfalfa)
Sequence length845
View on JBrowse
Gene Expression Atlas
Gene Ontology
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0006465 signal peptide processing
cellular_component GO:0016021 integral component of membrane
molecular_function GO:0008233 peptidase activity
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Scc4a34_26supercontigScc4a34_26:401937..405380 +
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Gene Ontology Update2017-11-12
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
Properties
Property NameValue
eAED0.25
QI25|0.87|0.88|1|0.75|0.66|9|142|225
AED0.25
NoteSignal peptidase I MAKER:126.9:0.25:Medtr2g103570
Relationships

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
MSAD_210110MSAD_210110Medicago sativagene


The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210110.t1MSAD_210110.t1-proteinMedicago sativapolypeptide


The following exon feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210110.t1:exon:176MSAD_210110.t1:exon:176Medicago sativaexon
MSAD_210110.t1:exon:177MSAD_210110.t1:exon:177Medicago sativaexon
MSAD_210110.t1:exon:178MSAD_210110.t1:exon:178Medicago sativaexon
MSAD_210110.t1:exon:179MSAD_210110.t1:exon:179Medicago sativaexon
MSAD_210110.t1:exon:180MSAD_210110.t1:exon:180Medicago sativaexon
MSAD_210110.t1:exon:181MSAD_210110.t1:exon:181Medicago sativaexon
MSAD_210110.t1:exon:182MSAD_210110.t1:exon:182Medicago sativaexon
MSAD_210110.t1:exon:183MSAD_210110.t1:exon:183Medicago sativaexon
MSAD_210110.t1:exon:184MSAD_210110.t1:exon:184Medicago sativaexon


The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210110.t1:cdsMSAD_210110.t1:cdsMedicago sativaCDS


Synonyms
The feature 'MSAD_210110.t1' has the following synonyms
Synonym
maker-Scc4a34_26-snap-gene-4.51-mRNA-1
Sequence

Variant Marked-up Sequence

>MSAD_210110.t1:1-500
        ACACTATTAACATAATTACATCCAATGGGAAAACAGAATTACGTAACACTGACACCCTTAACCGAATTACATCCAATCAGAAAACAGATAATAAAATTAGACATTTTTTTTCACTCTATGCAAAATAGAAGCAACAATTTTCTCATTCAAGAAAGAAACGCAATGGGTTTCGTTGGTGACACTGTCGATTCCATCAAATCTCTTCAGATCCGTCAGGTCCTCACTCAGGCTGTTAGCCTTGGCATGATTGTTACGTCTGCACTGATAATATGGAAGGCATTGATGTGCATCACTGGCAGTGAATCTCCTGTTGTCGTTGTTCTTTCTGGAAGTATGGAACCGGGATTCAAACGGGACATCTTGTTCTTACACATGAGTAAGGATCCAATTCGCGCAGGAGAGATTGTTGTATTTAATATAGATGGGCGAGAGATTCCGATCGTGCATCGTGTAATTAAGGTACATGAAAGAGGAGATACTGGGGAGGTTGATGTTCTCAC      

FASTA Record

The following sequence is that of the mRNA without any variants taken into account.

>MSAD_210110.t1:1-500
        ACACTATTAACATAATTACATCCAATGGGAAAACAGAATTACGTAACACTGACACCCTTAACCGAATTACATCCAATCAGAAAACAGATAATAAAATTAGACATTTTTTTTCACTCTATGCAAAATAGAAGCAACAATTTTCTCATTCAAGAAAGAAACGCAATGGGTTTCGTTGGTGACACTGTCGATTCCATCAAATCTCTTCAGATCCGTCAGGTCCTCACTCAGGCTGTTAGCCTTGGCATGATTGTTACGTCTGCACTGATAATATGGAAGGCATTGATGTGCATCACTGGCAGTGAATCTCCTGTTGTCGTTGTTCTTTCTGGAAGTATGGAACCGGGATTCAAACGGGACATCTTGTTCTTACACATGAGTAAGGATCCAATTCGCGCAGGAGAGATTGTTGTATTTAATATAGATGGGCGAGAGATTCCGATCGTGCATCGTGTAATTAAGGTACATGAAAGAGGAGATACTGGGGAGGTTGATGTTCTCAC