MSAD_210111.t1 (mRNA; Medicago sativa )

Overview
NameMSAD_210111.t1
Unique NameMSAD_210111.t1
TypemRNA
OrganismMedicago sativa (alfalfa)
Sequence length1640
View on JBrowse
Gene Expression Atlas
Gene Ontology
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0000460 maturation of 5.8S rRNA
biological_process GO:0000470 maturation of LSU-rRNA
cellular_component GO:0005730 nucleolus
cellular_component GO:0030687 preribosome, large subunit precursor
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Scc4a34_26supercontigScc4a34_26:406465..413625 -
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Gene Ontology Update2017-11-12
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
Properties
Property NameValue
eAED0.11
QI0|0.81|0.75|0.91|0.81|0.91|12|434|401
AED0.11
NoteMAK16 protein carboxy-terminal region protein MAKER:33.7:0.11:Medtr2g103560
Relationships

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
MSAD_210111MSAD_210111Medicago sativagene


The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210111.t1MSAD_210111.t1-proteinMedicago sativapolypeptide


The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210111.t1:cdsMSAD_210111.t1:cdsMedicago sativaCDS


The following exon feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210111.t1:exon:209MSAD_210111.t1:exon:209Medicago sativaexon
MSAD_210111.t1:exon:210MSAD_210111.t1:exon:210Medicago sativaexon
MSAD_210111.t1:exon:211MSAD_210111.t1:exon:211Medicago sativaexon
MSAD_210111.t1:exon:212MSAD_210111.t1:exon:212Medicago sativaexon
MSAD_210111.t1:exon:213MSAD_210111.t1:exon:213Medicago sativaexon
MSAD_210111.t1:exon:214MSAD_210111.t1:exon:214Medicago sativaexon
MSAD_210111.t1:exon:215MSAD_210111.t1:exon:215Medicago sativaexon
MSAD_210111.t1:exon:216MSAD_210111.t1:exon:216Medicago sativaexon
MSAD_210111.t1:exon:217MSAD_210111.t1:exon:217Medicago sativaexon
MSAD_210111.t1:exon:218MSAD_210111.t1:exon:218Medicago sativaexon
MSAD_210111.t1:exon:219MSAD_210111.t1:exon:219Medicago sativaexon
MSAD_210111.t1:exon:220MSAD_210111.t1:exon:220Medicago sativaexon


Synonyms
The feature 'MSAD_210111.t1' has the following synonyms
Synonym
maker-Scc4a34_26-augustus-gene-4.47-mRNA-1
Sequence

Variant Marked-up Sequence

>MSAD_210111.t1:1-500
        TGGATAATAGGATTTCAACCAGAGTGAACCTTCTACGATGTCGAGTTTTGAGATATTATGAGGCAGATGTCATGTGTGCTTTATGCGGGGAGGAGCCAAATGCGAGGTTTTCGTTTAAACTCAAAACAACAGACACTTCATACCTCGCCGCTGTCACACCTACACGGTTGCCGGAGAACAGCTTCCACAGTTTGATTCCAAAGATGCAGCACGATGAGGTTATATGGCAAGTTATCAGACACAATCATTGCAGTTTCATGACCAAAATTACGACGGGGAATTTTTGTAGAAACCCTTACAATGTCACTGGAATTTGTAACCGAAGCTCTTGCCCTTTAGCTAATAGTCGCTATGCCACCATTCGTGAAGACAAAGGAGTTTTTTACCTTTACATGAAGACTATTGAAAGAGCTCATACGCCAAAGGATTTGTGGGAAAGAGTTAAGCTGCCTAGGAATTACGAACAGGCACTTGGAGTCATCGACAAACATCTGATGTAT      

FASTA Record

The following sequence is that of the mRNA without any variants taken into account.

>MSAD_210111.t1:1-500
        TGGATAATAGGATTTCAACCAGAGTGAACCTTCTACGATGTCGAGTTTTGAGATATTATGAGGCAGATGTCATGTGTGCTTTATGCGGGGAGGAGCCAAATGCGAGGTTTTCGTTTAAACTCAAAACAACAGACACTTCATACCTCGCCGCTGTCACACCTACACGGTTGCCGGAGAACAGCTTCCACAGTTTGATTCCAAAGATGCAGCACGATGAGGTTATATGGCAAGTTATCAGACACAATCATTGCAGTTTCATGACCAAAATTACGACGGGGAATTTTTGTAGAAACCCTTACAATGTCACTGGAATTTGTAACCGAAGCTCTTGCCCTTTAGCTAATAGTCGCTATGCCACCATTCGTGAAGACAAAGGAGTTTTTTACCTTTACATGAAGACTATTGAAAGAGCTCATACGCCAAAGGATTTGTGGGAAAGAGTTAAGCTGCCTAGGAATTACGAACAGGCACTTGGAGTCATCGACAAACATCTGATGTAT