MSAD_210112.t1 (mRNA; Medicago sativa )

Overview
NameMSAD_210112.t1
Unique NameMSAD_210112.t1
TypemRNA
OrganismMedicago sativa (alfalfa)
Sequence length1320
View on JBrowse
Gene Expression Atlas
Gene Ontology
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0009451 RNA modification
cellular_component GO:0043231 intracellular membrane-bounded organelle
molecular_function GO:0004519 endonuclease activity
molecular_function GO:0003723 RNA binding
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Scc4a34_26supercontigScc4a34_26:417420..418739 +
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Gene Ontology Update2017-11-12
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
Properties
Property NameValue
eAED0.27
QI0|-1|0|1|-1|1|1|0|439
AED0.27
NotePPR containing plant-like protein MAKER:10.1:0.27:Medtr2g103550
Relationships

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
MSAD_210112MSAD_210112Medicago sativagene


The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210112.t1MSAD_210112.t1-proteinMedicago sativapolypeptide


The following exon feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210112.t1:exon:185MSAD_210112.t1:exon:185Medicago sativaexon


The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210112.t1:cdsMSAD_210112.t1:cdsMedicago sativaCDS


Synonyms
The feature 'MSAD_210112.t1' has the following synonyms
Synonym
augustus_masked-Scc4a34_26-processed-gene-4.5-mRNA-1
Sequence

Variant Marked-up Sequence

>MSAD_210112.t1:1-500
        TGTTCTTCACCATTGTCGAAGAATTCGAGCATGATCCTCTCACTCTTTCCCTGATCATGCTAATTACCTCTCTGCGATCCACTCGCACTCTCTTGAAAATTTTCGCACCTTCTTCCACAGCCATTAAAACCCTAAAACCTTCAAAACCCGCTCTTGAAGTCCCCAAATCGGAGTTGAAACCTTCAAAACCCGCTCTTGAAGCCCTCAAATCGGAGTGGAAACCTTCAAAACCCGCTCTTGAAGCCCTCAAATCGGAGTGGGACCCACATAAACTCTTCCACATCTTCAAATCCAATGCCACCAATCCCATCGTCGTTGAAAATCGCTTCGCCTTTTACGACACCATTTCGCGTCTCGCCAGTGCTAAACGATTCGATTACATTGAGCAATTACTCGAACAGCAGAAGAAGTTACCGCAATCACGCCGTGAAGGGTTTGTTGTAAGAATTATTACATTGTATGGTAAGGCTGGTATGATTCAACATGCTTTGAATACTTTT      

FASTA Record

The following sequence is that of the mRNA without any variants taken into account.

>MSAD_210112.t1:1-500
        TGTTCTTCACCATTGTCGAAGAATTCGAGCATGATCCTCTCACTCTTTCCCTGATCATGCTAATTACCTCTCTGCGATCCACTCGCACTCTCTTGAAAATTTTCGCACCTTCTTCCACAGCCATTAAAACCCTAAAACCTTCAAAACCCGCTCTTGAAGTCCCCAAATCGGAGTTGAAACCTTCAAAACCCGCTCTTGAAGCCCTCAAATCGGAGTGGAAACCTTCAAAACCCGCTCTTGAAGCCCTCAAATCGGAGTGGGACCCACATAAACTCTTCCACATCTTCAAATCCAATGCCACCAATCCCATCGTCGTTGAAAATCGCTTCGCCTTTTACGACACCATTTCGCGTCTCGCCAGTGCTAAACGATTCGATTACATTGAGCAATTACTCGAACAGCAGAAGAAGTTACCGCAATCACGCCGTGAAGGGTTTGTTGTAAGAATTATTACATTGTATGGTAAGGCTGGTATGATTCAACATGCTTTGAATACTTTT