MSAD_210143.t1 (mRNA; Medicago sativa )

Overview
NameMSAD_210143.t1
Unique NameMSAD_210143.t1
TypemRNA
OrganismMedicago sativa (alfalfa)
Sequence length4117
View on JBrowse
Gene Expression Atlas
Gene Ontology
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0005975 carbohydrate metabolic process
molecular_function GO:0004553 hydrolase activity, hydrolyzing O-glycosyl compounds
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Scc4a34_26supercontigScc4a34_26:752489..760535 -
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Gene Ontology Update2017-11-12
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
Properties
Property NameValue
eAED0.12
QI27|0.92|0.93|1|0.92|0.86|15|2470|539
AED0.12
NoteGlycoside hydrolase family 1 protein MAKER:26.1:0.12:Medtr2g079580
Relationships

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
MSAD_210143MSAD_210143Medicago sativagene


The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210143.t1MSAD_210143.t1-proteinMedicago sativapolypeptide


The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210143.t1:cdsMSAD_210143.t1:cdsMedicago sativaCDS


The following exon feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210143.t1:exon:323MSAD_210143.t1:exon:323Medicago sativaexon
MSAD_210143.t1:exon:324MSAD_210143.t1:exon:324Medicago sativaexon
MSAD_210143.t1:exon:325MSAD_210143.t1:exon:325Medicago sativaexon
MSAD_210143.t1:exon:326MSAD_210143.t1:exon:326Medicago sativaexon
MSAD_210143.t1:exon:327MSAD_210143.t1:exon:327Medicago sativaexon
MSAD_210143.t1:exon:328MSAD_210143.t1:exon:328Medicago sativaexon
MSAD_210143.t1:exon:329MSAD_210143.t1:exon:329Medicago sativaexon
MSAD_210143.t1:exon:330MSAD_210143.t1:exon:330Medicago sativaexon
MSAD_210143.t1:exon:331MSAD_210143.t1:exon:331Medicago sativaexon
MSAD_210143.t1:exon:332MSAD_210143.t1:exon:332Medicago sativaexon
MSAD_210143.t1:exon:333MSAD_210143.t1:exon:333Medicago sativaexon
MSAD_210143.t1:exon:334MSAD_210143.t1:exon:334Medicago sativaexon
MSAD_210143.t1:exon:335MSAD_210143.t1:exon:335Medicago sativaexon
MSAD_210143.t1:exon:336MSAD_210143.t1:exon:336Medicago sativaexon
MSAD_210143.t1:exon:337MSAD_210143.t1:exon:337Medicago sativaexon


Synonyms
The feature 'MSAD_210143.t1' has the following synonyms
Synonym
maker-Scc4a34_26-augustus-gene-7.22-mRNA-1
Sequence

Variant Marked-up Sequence

>MSAD_210143.t1:1-500
        TGAAAATGTGTTTGCTACACAGTTGAATGAAAATGCAAAAATGGTTTATGCATGTTGTGTTTACACTGCTTTGCTCTTCTCTTTTACATGTTCAAAGTTCTCATGAAGTTGATGATGAAATCAGTAGATCTCAATTCCCAAATGGCTTCCTCTTTGGAGCAAGCACTTCCTCTTATCAGATTGAAGGAGCAGCTTTTGAAGATGGTAAAGGTTTAAGCAACTGGGATGTATTCAGTCACAAACCAGGAATGATAAACAATGATGAGAATGGTGATATAGCAAATGATCATTATCATCACTATTTGGAAGATATCAAATTGATGTCATCACTTGGGATAAATGTATATAGATTTTCAATTTCATGGTCTAGGATTCTACCTAGAGGGATATATGGGGACATAAATCCAAGTGGAGTTATGTTCTACAACAATCTTATAGACAATCTGCTACTTAGAGGAATTGAGCCATTTGTGACAATTCATCATCAAGACTGGCCACAA      

FASTA Record

The following sequence is that of the mRNA without any variants taken into account.

>MSAD_210143.t1:1-500
        TGAAAATGTGTTTGCTACACAGTTGAATGAAAATGCAAAAATGGTTTATGCATGTTGTGTTTACACTGCTTTGCTCTTCTCTTTTACATGTTCAAAGTTCTCATGAAGTTGATGATGAAATCAGTAGATCTCAATTCCCAAATGGCTTCCTCTTTGGAGCAAGCACTTCCTCTTATCAGATTGAAGGAGCAGCTTTTGAAGATGGTAAAGGTTTAAGCAACTGGGATGTATTCAGTCACAAACCAGGAATGATAAACAATGATGAGAATGGTGATATAGCAAATGATCATTATCATCACTATTTGGAAGATATCAAATTGATGTCATCACTTGGGATAAATGTATATAGATTTTCAATTTCATGGTCTAGGATTCTACCTAGAGGGATATATGGGGACATAAATCCAAGTGGAGTTATGTTCTACAACAATCTTATAGACAATCTGCTACTTAGAGGAATTGAGCCATTTGTGACAATTCATCATCAAGACTGGCCACAA