MSAD_210144.t1 (mRNA; Medicago sativa )

Overview
NameMSAD_210144.t1
Unique NameMSAD_210144.t1
TypemRNA
OrganismMedicago sativa (alfalfa)
Sequence length2436
View on JBrowse
Gene Expression Atlas
Gene Ontology
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
molecular_function GO:0016301 kinase activity
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Scc4a34_26supercontigScc4a34_26:777503..789872 -
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Gene Ontology Update2017-11-12
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
Properties
Property NameValue
eAED0.16
QI260|1|1|1|0.95|0.90|22|418|585
AED0.16
NoteLRR receptor-like kinase MAKER:13.9:0.16:Medtr2g079560
Relationships

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
MSAD_210144MSAD_210144Medicago sativagene


The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210144.t1MSAD_210144.t1-proteinMedicago sativapolypeptide


The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210144.t1:cdsMSAD_210144.t1:cdsMedicago sativaCDS


The following exon feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210144.t1:exon:399MSAD_210144.t1:exon:399Medicago sativaexon
MSAD_210144.t1:exon:400MSAD_210144.t1:exon:400Medicago sativaexon
MSAD_210144.t1:exon:401MSAD_210144.t1:exon:401Medicago sativaexon
MSAD_210144.t1:exon:402MSAD_210144.t1:exon:402Medicago sativaexon
MSAD_210144.t1:exon:403MSAD_210144.t1:exon:403Medicago sativaexon
MSAD_210144.t1:exon:404MSAD_210144.t1:exon:404Medicago sativaexon
MSAD_210144.t1:exon:405MSAD_210144.t1:exon:405Medicago sativaexon
MSAD_210144.t1:exon:406MSAD_210144.t1:exon:406Medicago sativaexon
MSAD_210144.t1:exon:407MSAD_210144.t1:exon:407Medicago sativaexon
MSAD_210144.t1:exon:408MSAD_210144.t1:exon:408Medicago sativaexon
MSAD_210144.t1:exon:409MSAD_210144.t1:exon:409Medicago sativaexon
MSAD_210144.t1:exon:410MSAD_210144.t1:exon:410Medicago sativaexon
MSAD_210144.t1:exon:411MSAD_210144.t1:exon:411Medicago sativaexon
MSAD_210144.t1:exon:412MSAD_210144.t1:exon:412Medicago sativaexon
MSAD_210144.t1:exon:413MSAD_210144.t1:exon:413Medicago sativaexon
MSAD_210144.t1:exon:414MSAD_210144.t1:exon:414Medicago sativaexon
MSAD_210144.t1:exon:415MSAD_210144.t1:exon:415Medicago sativaexon
MSAD_210144.t1:exon:416MSAD_210144.t1:exon:416Medicago sativaexon
MSAD_210144.t1:exon:417MSAD_210144.t1:exon:417Medicago sativaexon
MSAD_210144.t1:exon:418MSAD_210144.t1:exon:418Medicago sativaexon
MSAD_210144.t1:exon:419MSAD_210144.t1:exon:419Medicago sativaexon
MSAD_210144.t1:exon:420MSAD_210144.t1:exon:420Medicago sativaexon


Synonyms
The feature 'MSAD_210144.t1' has the following synonyms
Synonym
maker-Scc4a34_26-augustus-gene-8.23-mRNA-1
Sequence

Variant Marked-up Sequence

>MSAD_210144.t1:1-500
        CAAAACCTCAACAAAAATATTAAGCAGCATATGAATTATAAGAAGCCAAAGTAAACAGAGATGAATTGATGAAACACCATTACTTCTTTTGTGAAATGATGATGATGTTACCCCAAATCCAAATAGAAGTGTAGTTAATTCATCTCATCCCATAATTTGAAATTCGGATGCAGAAATCACCAGCATCCTTCTTCACTTCTTATCTCTGAATTTCCATCAACGATCTTGAATCCGATCCAATCAAGTTGGCGCCATTTCCATGGATCGGCTTCTCAAATCCGCCAGATCATCCGGTTCTCTCAACCTCTCCAACCGCTCCCTCAGTGAAGTCCCCGATGAGGTTTATCGCAATCTCGACGGAATCGGTGGTGATGATGATAAATGGTGGGAGGCTGTGGAGCTTCAGAAACTCATTTTGGCTCACAATAGTATTGAATTGTTAAAGGAAGATATCAGAAATTTATCTTGTCTCGTTGTTTTGAATCTTAGCCACAATAGTC      

FASTA Record

The following sequence is that of the mRNA without any variants taken into account.

>MSAD_210144.t1:1-500
        CAAAACCTCAACAAAAATATTAAGCAGCATATGAATTATAAGAAGCCAAAGTAAACAGAGATGAATTGATGAAACACCATTACTTCTTTTGTGAAATGATGATGATGTTACCCCAAATCCAAATAGAAGTGTAGTTAATTCATCTCATCCCATAATTTGAAATTCGGATGCAGAAATCACCAGCATCCTTCTTCACTTCTTATCTCTGAATTTCCATCAACGATCTTGAATCCGATCCAATCAAGTTGGCGCCATTTCCATGGATCGGCTTCTCAAATCCGCCAGATCATCCGGTTCTCTCAACCTCTCCAACCGCTCCCTCAGTGAAGTCCCCGATGAGGTTTATCGCAATCTCGACGGAATCGGTGGTGATGATGATAAATGGTGGGAGGCTGTGGAGCTTCAGAAACTCATTTTGGCTCACAATAGTATTGAATTGTTAAAGGAAGATATCAGAAATTTATCTTGTCTCGTTGTTTTGAATCTTAGCCACAATAGTC