Scc4a34_26 (supercontig; Medicago sativa )

Overview
NameScc4a34_26
Unique NameScc4a34_26
Typesupercontig
OrganismMedicago sativa (alfalfa)
Sequence length1853931
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
MSAD_210066geneMSAD_210066:41933..45595 +
MSAD_210066.t1mRNAMSAD_210066.t1:41933..45595 +
MSAD_210066.t1:exon:0exonMSAD_210066.t1:exon:0:41933..43591 +
MSAD_210066.t1:exon:1exonMSAD_210066.t1:exon:1:44026..44198 +
MSAD_210066.t1:exon:2exonMSAD_210066.t1:exon:2:45154..45595 +
MSAD_210066.t1:cdsCDSMSAD_210066.t1:cds:43094..43591 +
MSAD_210066.t1:cdsCDSMSAD_210066.t1:cds:44026..44198 +
MSAD_210066.t1:cdsCDSMSAD_210066.t1:cds:45154..45310 +
MSAD_210063geneMSAD_210063:7641..9088 +
MSAD_210063.t1mRNAMSAD_210063.t1:7641..9088 +
MSAD_210063.t1:exon:3exonMSAD_210063.t1:exon:3:7641..7943 +
MSAD_210063.t1:exon:4exonMSAD_210063.t1:exon:4:8297..9088 +
MSAD_210063.t1:cdsCDSMSAD_210063.t1:cds:7775..7943 +
MSAD_210063.t1:cdsCDSMSAD_210063.t1:cds:8297..8535 +
MSAD_210065geneMSAD_210065:29148..29715 +
MSAD_210065.t1mRNAMSAD_210065.t1:29148..29715 +
MSAD_210065.t1:exon:5exonMSAD_210065.t1:exon:5:29148..29229 +
MSAD_210065.t1:exon:6exonMSAD_210065.t1:exon:6:29453..29715 +
MSAD_210065.t1:cdsCDSMSAD_210065.t1:cds:29148..29229 +
MSAD_210065.t1:cdsCDSMSAD_210065.t1:cds:29453..29715 +
MSAD_210069geneMSAD_210069:60079..62797 -
MSAD_210069.t1mRNAMSAD_210069.t1:60079..62797 -
MSAD_210069.t1:exon:8exonMSAD_210069.t1:exon:8:60079..61315 -
MSAD_210069.t1:exon:7exonMSAD_210069.t1:exon:7:62438..62797 -
MSAD_210069.t1:cdsCDSMSAD_210069.t1:cds:62438..62698 -
MSAD_210069.t1:cdsCDSMSAD_210069.t1:cds:60914..61315 -
MSAD_210067geneMSAD_210067:45754..48162 -
MSAD_210067.t1mRNAMSAD_210067.t1:45754..48162 -
MSAD_210067.t1:exon:9exonMSAD_210067.t1:exon:9:45754..48162 -
MSAD_210067.t1:cdsCDSMSAD_210067.t1:cds:45754..48162 -
MSAD_210068geneMSAD_210068:48229..55451 -
MSAD_210068.t1mRNAMSAD_210068.t1:48229..55451 -
MSAD_210068.t1:exon:15exonMSAD_210068.t1:exon:15:55437..55451 -
MSAD_210068.t1:exon:14exonMSAD_210068.t1:exon:14:53552..53680 -
MSAD_210068.t1:exon:13exonMSAD_210068.t1:exon:13:53336..53414 -
MSAD_210068.t1:exon:12exonMSAD_210068.t1:exon:12:52470..52591 -
MSAD_210068.t1:exon:11exonMSAD_210068.t1:exon:11:48294..48341 -
MSAD_210068.t1:exon:10exonMSAD_210068.t1:exon:10:48229..48237 -
MSAD_210068.t1:cdsCDSMSAD_210068.t1:cds:55437..55451 -
MSAD_210068.t1:cdsCDSMSAD_210068.t1:cds:53552..53680 -
MSAD_210068.t1:cdsCDSMSAD_210068.t1:cds:53336..53414 -
MSAD_210068.t1:cdsCDSMSAD_210068.t1:cds:52470..52591 -
MSAD_210068.t1:cdsCDSMSAD_210068.t1:cds:48294..48341 -
MSAD_210068.t1:cdsCDSMSAD_210068.t1:cds:48229..48237 -
MSAD_210064geneMSAD_210064:15785..17432 +
MSAD_210064.t1mRNAMSAD_210064.t1:15785..17432 +
MSAD_210064.t1:exon:16exonMSAD_210064.t1:exon:16:15785..15904 +
MSAD_210064.t1:exon:17exonMSAD_210064.t1:exon:17:16701..17432 +
MSAD_210064.t1:cdsCDSMSAD_210064.t1:cds:15785..15904 +
MSAD_210064.t1:cdsCDSMSAD_210064.t1:cds:16701..17432 +
MSAD_210076geneMSAD_210076:129392..131746 +
MSAD_210076.t1mRNAMSAD_210076.t1:129392..131746 +
MSAD_210076.t1:exon:18exonMSAD_210076.t1:exon:18:129392..129974 +
MSAD_210076.t1:exon:19exonMSAD_210076.t1:exon:19:130939..131248 +
MSAD_210076.t1:exon:20exonMSAD_210076.t1:exon:20:131396..131746 +
MSAD_210076.t1:cdsCDSMSAD_210076.t1:cds:129451..129974 +
MSAD_210076.t1:cdsCDSMSAD_210076.t1:cds:130939..131248 +
MSAD_210076.t1:cdsCDSMSAD_210076.t1:cds:131396..131746 +
MSAD_210080geneMSAD_210080:172860..174407 +
MSAD_210080.t1mRNAMSAD_210080.t1:172860..174407 +
MSAD_210080.t1:exon:21exonMSAD_210080.t1:exon:21:172860..173203 +
MSAD_210080.t1:exon:22exonMSAD_210080.t1:exon:22:173491..173634 +
MSAD_210080.t1:exon:23exonMSAD_210080.t1:exon:23:173955..174027 +
MSAD_210080.t1:exon:24exonMSAD_210080.t1:exon:24:174143..174407 +
MSAD_210080.t1:cdsCDSMSAD_210080.t1:cds:172860..173203 +
MSAD_210080.t1:cdsCDSMSAD_210080.t1:cds:173491..173634 +
MSAD_210080.t1:cdsCDSMSAD_210080.t1:cds:173955..174027 +
MSAD_210080.t1:cdsCDSMSAD_210080.t1:cds:174143..174202 +
MSAD_210071geneMSAD_210071:80045..91157 +
MSAD_210071.t1mRNAMSAD_210071.t1:80045..91157 +
MSAD_210071.t1:exon:25exonMSAD_210071.t1:exon:25:80045..80468 +
MSAD_210071.t1:exon:26exonMSAD_210071.t1:exon:26:80728..80965 +
MSAD_210071.t1:exon:27exonMSAD_210071.t1:exon:27:80998..81189 +
MSAD_210071.t1:exon:28exonMSAD_210071.t1:exon:28:81351..82141 +
MSAD_210071.t1:exon:29exonMSAD_210071.t1:exon:29:82258..82343 +
MSAD_210071.t1:exon:30exonMSAD_210071.t1:exon:30:82754..82936 +
MSAD_210071.t1:exon:31exonMSAD_210071.t1:exon:31:83095..83409 +
MSAD_210071.t1:exon:32exonMSAD_210071.t1:exon:32:83495..83799 +
MSAD_210071.t1:exon:33exonMSAD_210071.t1:exon:33:83881..84335 +
MSAD_210071.t1:exon:34exonMSAD_210071.t1:exon:34:84426..84552 +
MSAD_210071.t1:exon:35exonMSAD_210071.t1:exon:35:85002..85243 +
MSAD_210071.t1:exon:36exonMSAD_210071.t1:exon:36:85321..85444 +
MSAD_210071.t1:exon:37exonMSAD_210071.t1:exon:37:85526..85715 +
MSAD_210071.t1:exon:38exonMSAD_210071.t1:exon:38:85825..85932 +
MSAD_210071.t1:exon:39exonMSAD_210071.t1:exon:39:86045..86236 +
MSAD_210071.t1:exon:40exonMSAD_210071.t1:exon:40:86247..86298 +
MSAD_210071.t1:exon:41exonMSAD_210071.t1:exon:41:87144..87743 +
MSAD_210071.t1:exon:42exonMSAD_210071.t1:exon:42:87829..87935 +
MSAD_210071.t1:exon:43exonMSAD_210071.t1:exon:43:88078..88332 +
MSAD_210071.t1:exon:44exonMSAD_210071.t1:exon:44:88416..88889 +
MSAD_210071.t1:exon:45exonMSAD_210071.t1:exon:45:89192..89353 +
MSAD_210071.t1:exon:46exonMSAD_210071.t1:exon:46:89503..89700 +
MSAD_210071.t1:exon:47exonMSAD_210071.t1:exon:47:89780..90058 +
MSAD_210071.t1:exon:48exonMSAD_210071.t1:exon:48:90163..90405 +
MSAD_210071.t1:exon:49exonMSAD_210071.t1:exon:49:90589..91157 +
MSAD_210071.t1:cdsCDSMSAD_210071.t1:cds:80045..80468 +
MSAD_210071.t1:cdsCDSMSAD_210071.t1:cds:80728..80965 +
MSAD_210071.t1:cdsCDSMSAD_210071.t1:cds:80998..81189 +
MSAD_210071.t1:cdsCDSMSAD_210071.t1:cds:81351..82141 +
MSAD_210071.t1:cdsCDSMSAD_210071.t1:cds:82258..82343 +
MSAD_210071.t1:cdsCDSMSAD_210071.t1:cds:82754..82936 +
MSAD_210071.t1:cdsCDSMSAD_210071.t1:cds:83095..83409 +
MSAD_210071.t1:cdsCDSMSAD_210071.t1:cds:83495..83799 +
MSAD_210071.t1:cdsCDSMSAD_210071.t1:cds:83881..84335 +
MSAD_210071.t1:cdsCDSMSAD_210071.t1:cds:84426..84552 +
MSAD_210071.t1:cdsCDSMSAD_210071.t1:cds:85002..85243 +
MSAD_210071.t1:cdsCDSMSAD_210071.t1:cds:85321..85444 +
MSAD_210071.t1:cdsCDSMSAD_210071.t1:cds:85526..85715 +
MSAD_210071.t1:cdsCDSMSAD_210071.t1:cds:85825..85932 +
MSAD_210071.t1:cdsCDSMSAD_210071.t1:cds:86045..86236 +
MSAD_210071.t1:cdsCDSMSAD_210071.t1:cds:86247..86298 +
MSAD_210071.t1:cdsCDSMSAD_210071.t1:cds:87144..87743 +
MSAD_210071.t1:cdsCDSMSAD_210071.t1:cds:87829..87935 +
MSAD_210071.t1:cdsCDSMSAD_210071.t1:cds:88078..88332 +
MSAD_210071.t1:cdsCDSMSAD_210071.t1:cds:88416..88889 +
MSAD_210071.t1:cdsCDSMSAD_210071.t1:cds:89192..89353 +
MSAD_210071.t1:cdsCDSMSAD_210071.t1:cds:89503..89700 +
MSAD_210071.t1:cdsCDSMSAD_210071.t1:cds:89780..90058 +
MSAD_210071.t1:cdsCDSMSAD_210071.t1:cds:90163..90405 +
MSAD_210071.t1:cdsCDSMSAD_210071.t1:cds:90589..90783 +
MSAD_210070geneMSAD_210070:76850..80036 +
MSAD_210070.t1mRNAMSAD_210070.t1:76850..80036 +
MSAD_210070.t1:exon:50exonMSAD_210070.t1:exon:50:76850..77143 +
MSAD_210070.t1:exon:51exonMSAD_210070.t1:exon:51:78772..78953 +
MSAD_210070.t1:exon:52exonMSAD_210070.t1:exon:52:79732..79919 +
MSAD_210070.t1:exon:53exonMSAD_210070.t1:exon:53:79987..80036 +
MSAD_210070.t1:cdsCDSMSAD_210070.t1:cds:76850..77143 +
MSAD_210070.t1:cdsCDSMSAD_210070.t1:cds:78772..78953 +
MSAD_210070.t1:cdsCDSMSAD_210070.t1:cds:79732..79919 +
MSAD_210070.t1:cdsCDSMSAD_210070.t1:cds:79987..80036 +
MSAD_210077geneMSAD_210077:144611..146398 -
MSAD_210077.t1mRNAMSAD_210077.t1:144611..146398 -
MSAD_210077.t1:exon:55exonMSAD_210077.t1:exon:55:145268..146398 -
MSAD_210077.t1:exon:54exonMSAD_210077.t1:exon:54:144611..144688 -
MSAD_210077.t1:cdsCDSMSAD_210077.t1:cds:145268..146398 -
MSAD_210077.t1:cdsCDSMSAD_210077.t1:cds:144611..144688 -
MSAD_210072geneMSAD_210072:101282..104487 -
MSAD_210072.t1mRNAMSAD_210072.t1:101282..104487 -
MSAD_210072.t1:exon:60exonMSAD_210072.t1:exon:60:101282..101706 -
MSAD_210072.t1:exon:59exonMSAD_210072.t1:exon:59:101738..101931 -
MSAD_210072.t1:exon:58exonMSAD_210072.t1:exon:58:102009..102271 -
MSAD_210072.t1:exon:57exonMSAD_210072.t1:exon:57:103155..103302 -
MSAD_210072.t1:exon:56exonMSAD_210072.t1:exon:56:104000..104487 -
MSAD_210072.t1:cdsCDSMSAD_210072.t1:cds:104000..104043 -
MSAD_210072.t1:cdsCDSMSAD_210072.t1:cds:103155..103302 -
MSAD_210072.t1:cdsCDSMSAD_210072.t1:cds:102009..102271 -
MSAD_210072.t1:cdsCDSMSAD_210072.t1:cds:101738..101931 -
MSAD_210072.t1:cdsCDSMSAD_210072.t1:cds:101282..101706 -
MSAD_210079geneMSAD_210079:163967..166885 -
MSAD_210079.t1mRNAMSAD_210079.t1:163967..166885 -
MSAD_210079.t1:exon:71exonMSAD_210079.t1:exon:71:163967..164256 -
MSAD_210079.t1:exon:70exonMSAD_210079.t1:exon:70:164348..164434 -
MSAD_210079.t1:exon:69exonMSAD_210079.t1:exon:69:164519..164596 -
MSAD_210079.t1:exon:68exonMSAD_210079.t1:exon:68:164695..164898 -
MSAD_210079.t1:exon:67exonMSAD_210079.t1:exon:67:165002..165122 -
MSAD_210079.t1:exon:66exonMSAD_210079.t1:exon:66:165224..165378 -
MSAD_210079.t1:exon:65exonMSAD_210079.t1:exon:65:165599..165734 -
MSAD_210079.t1:exon:64exonMSAD_210079.t1:exon:64:165841..165925 -
MSAD_210079.t1:exon:63exonMSAD_210079.t1:exon:63:166052..166173 -
MSAD_210079.t1:exon:62exonMSAD_210079.t1:exon:62:166258..166354 -
MSAD_210079.t1:exon:61exonMSAD_210079.t1:exon:61:166462..166885 -
MSAD_210079.t1:cdsCDSMSAD_210079.t1:cds:166462..166885 -
MSAD_210079.t1:cdsCDSMSAD_210079.t1:cds:166258..166354 -
MSAD_210079.t1:cdsCDSMSAD_210079.t1:cds:166052..166173 -
MSAD_210079.t1:cdsCDSMSAD_210079.t1:cds:165841..165925 -
MSAD_210079.t1:cdsCDSMSAD_210079.t1:cds:165599..165734 -
MSAD_210079.t1:cdsCDSMSAD_210079.t1:cds:165224..165378 -
MSAD_210079.t1:cdsCDSMSAD_210079.t1:cds:165002..165122 -
MSAD_210079.t1:cdsCDSMSAD_210079.t1:cds:164695..164898 -
MSAD_210079.t1:cdsCDSMSAD_210079.t1:cds:164519..164596 -
MSAD_210079.t1:cdsCDSMSAD_210079.t1:cds:164348..164434 -
MSAD_210079.t1:cdsCDSMSAD_210079.t1:cds:164083..164256 -
MSAD_210074geneMSAD_210074:120019..121725 -
MSAD_210074.t1mRNAMSAD_210074.t1:120019..121725 -
MSAD_210074.t1:exon:75exonMSAD_210074.t1:exon:75:121714..121725 -
MSAD_210074.t1:exon:74exonMSAD_210074.t1:exon:74:120813..120930 -
MSAD_210074.t1:exon:73exonMSAD_210074.t1:exon:73:120533..120750 -
MSAD_210074.t1:exon:72exonMSAD_210074.t1:exon:72:120019..120459 -
MSAD_210074.t1:cdsCDSMSAD_210074.t1:cds:121714..121725 -
MSAD_210074.t1:cdsCDSMSAD_210074.t1:cds:120813..120930 -
MSAD_210074.t1:cdsCDSMSAD_210074.t1:cds:120533..120750 -
MSAD_210074.t1:cdsCDSMSAD_210074.t1:cds:120019..120459 -
MSAD_210073geneMSAD_210073:119457..120014 -
MSAD_210073.t1mRNAMSAD_210073.t1:119457..120014 -
MSAD_210073.t1:exon:77exonMSAD_210073.t1:exon:77:119809..120014 -
MSAD_210073.t1:exon:76exonMSAD_210073.t1:exon:76:119457..119748 -
MSAD_210073.t1:cdsCDSMSAD_210073.t1:cds:119809..120014 -
MSAD_210073.t1:cdsCDSMSAD_210073.t1:cds:119457..119748 -
MSAD_210078geneMSAD_210078:161399..163103 -
MSAD_210078.t1mRNAMSAD_210078.t1:161399..163103 -
MSAD_210078.t1:exon:81exonMSAD_210078.t1:exon:81:163084..163103 -
MSAD_210078.t1:exon:80exonMSAD_210078.t1:exon:80:162436..162496 -
MSAD_210078.t1:exon:79exonMSAD_210078.t1:exon:79:161917..162348 -
MSAD_210078.t1:exon:78exonMSAD_210078.t1:exon:78:161399..161665 -
MSAD_210078.t1:cdsCDSMSAD_210078.t1:cds:163084..163103 -
MSAD_210078.t1:cdsCDSMSAD_210078.t1:cds:162436..162496 -
MSAD_210078.t1:cdsCDSMSAD_210078.t1:cds:161917..162348 -
MSAD_210078.t1:cdsCDSMSAD_210078.t1:cds:161399..161665 -
MSAD_210075geneMSAD_210075:124809..126914 -
MSAD_210075.t1mRNAMSAD_210075.t1:124809..126914 -
MSAD_210075.t1:exon:83exonMSAD_210075.t1:exon:83:125419..126914 -
MSAD_210075.t1:exon:82exonMSAD_210075.t1:exon:82:124809..124842 -
MSAD_210075.t1:cdsCDSMSAD_210075.t1:cds:125419..126914 -
MSAD_210075.t1:cdsCDSMSAD_210075.t1:cds:124809..124842 -
MSAD_210086geneMSAD_210086:222026..225572 +
MSAD_210086.t1mRNAMSAD_210086.t1:222026..225572 +
MSAD_210086.t1:exon:84exonMSAD_210086.t1:exon:84:222026..222406 +
MSAD_210086.t1:exon:85exonMSAD_210086.t1:exon:85:222496..225572 +
MSAD_210086.t1:cdsCDSMSAD_210086.t1:cds:222396..222406 +
MSAD_210086.t1:cdsCDSMSAD_210086.t1:cds:222496..224950 +
MSAD_210084geneMSAD_210084:208480..210924 +
MSAD_210084.t1mRNAMSAD_210084.t1:208480..210924 +
MSAD_210084.t1:exon:86exonMSAD_210084.t1:exon:86:208480..208866 +
MSAD_210084.t1:exon:87exonMSAD_210084.t1:exon:87:209955..210924 +
MSAD_210084.t1:cdsCDSMSAD_210084.t1:cds:208606..208866 +
MSAD_210084.t1:cdsCDSMSAD_210084.t1:cds:209955..210356 +
MSAD_210081geneMSAD_210081:191668..194039 +
MSAD_210081.t1mRNAMSAD_210081.t1:191668..194039 +
MSAD_210081.t1:exon:88exonMSAD_210081.t1:exon:88:191668..192026 +
MSAD_210081.t1:exon:89exonMSAD_210081.t1:exon:89:193278..194039 +
MSAD_210081.t1:cdsCDSMSAD_210081.t1:cds:191763..192026 +
MSAD_210081.t1:cdsCDSMSAD_210081.t1:cds:193278..193763 +
MSAD_210083geneMSAD_210083:200062..200340 +
MSAD_210083.t1mRNAMSAD_210083.t1:200062..200340 +
MSAD_210083.t1:exon:90exonMSAD_210083.t1:exon:90:200062..200340 +
MSAD_210083.t1:cdsCDSMSAD_210083.t1:cds:200062..200340 +
MSAD_210088geneMSAD_210088:229056..230633 +
MSAD_210088.t1mRNAMSAD_210088.t1:229056..230633 +
MSAD_210088.t1:exon:91exonMSAD_210088.t1:exon:91:229056..229100 +
MSAD_210088.t1:exon:92exonMSAD_210088.t1:exon:92:229702..229764 +
MSAD_210088.t1:exon:93exonMSAD_210088.t1:exon:93:230018..230110 +
MSAD_210088.t1:exon:94exonMSAD_210088.t1:exon:94:230628..230633 +
MSAD_210088.t1:cdsCDSMSAD_210088.t1:cds:229056..229100 +
MSAD_210088.t1:cdsCDSMSAD_210088.t1:cds:229702..229764 +
MSAD_210088.t1:cdsCDSMSAD_210088.t1:cds:230018..230110 +
MSAD_210088.t1:cdsCDSMSAD_210088.t1:cds:230628..230633 +
MSAD_210087geneMSAD_210087:225133..228697 -
MSAD_210087.t1mRNAMSAD_210087.t1:225133..228697 -
MSAD_210087.t1:exon:96exonMSAD_210087.t1:exon:96:225133..226694 -
MSAD_210087.t1:exon:95exonMSAD_210087.t1:exon:95:227129..228697 -
MSAD_210087.t1:cdsCDSMSAD_210087.t1:cds:227129..227626 -
MSAD_210087.t1:cdsCDSMSAD_210087.t1:cds:226518..226694 -
MSAD_210089geneMSAD_210089:247690..248521 -
MSAD_210089.t1mRNAMSAD_210089.t1:247690..248521 -
MSAD_210089.t1:exon:98exonMSAD_210089.t1:exon:98:247690..248204 -
MSAD_210089.t1:exon:97exonMSAD_210089.t1:exon:97:248432..248521 -
MSAD_210089.t1:cdsCDSMSAD_210089.t1:cds:248432..248513 -
MSAD_210089.t1:cdsCDSMSAD_210089.t1:cds:247942..248204 -
MSAD_210091geneMSAD_210091:274407..279064 -
MSAD_210091.t1mRNAMSAD_210091.t1:274407..279064 -
MSAD_210091.t1:exon:101exonMSAD_210091.t1:exon:101:279038..279064 -
MSAD_210091.t1:exon:100exonMSAD_210091.t1:exon:100:275939..276052 -
MSAD_210091.t1:exon:99exonMSAD_210091.t1:exon:99:274407..275138 -
MSAD_210091.t1:cdsCDSMSAD_210091.t1:cds:279038..279064 -
MSAD_210091.t1:cdsCDSMSAD_210091.t1:cds:275939..276052 -
MSAD_210091.t1:cdsCDSMSAD_210091.t1:cds:274407..275138 -
MSAD_210085geneMSAD_210085:217207..217507 -
MSAD_210085.t1mRNAMSAD_210085.t1:217207..217507 -
MSAD_210085.t1:exon:105exonMSAD_210085.t1:exon:105:217320..217507 -
MSAD_210085.t1:exon:104exonMSAD_210085.t1:exon:104:217207..217294 -
MSAD_210085.t1:cdsCDSMSAD_210085.t1:cds:217320..217507 -
MSAD_210085.t1:cdsCDSMSAD_210085.t1:cds:217207..217294 -
MSAD_210082geneMSAD_210082:199134..199419 -
MSAD_210082.t1mRNAMSAD_210082.t1:199134..199419 -
MSAD_210082.t1:exon:108exonMSAD_210082.t1:exon:108:199363..199419 -
MSAD_210082.t1:exon:107exonMSAD_210082.t1:exon:107:199223..199330 -
MSAD_210082.t1:exon:106exonMSAD_210082.t1:exon:106:199134..199208 -
MSAD_210082.t1:cdsCDSMSAD_210082.t1:cds:199363..199419 -
MSAD_210082.t1:cdsCDSMSAD_210082.t1:cds:199223..199330 -
MSAD_210082.t1:cdsCDSMSAD_210082.t1:cds:199134..199208 -
MSAD_210099geneMSAD_210099:342108..342506 +
MSAD_210099.t1mRNAMSAD_210099.t1:342108..342506 +
MSAD_210099.t1:exon:109exonMSAD_210099.t1:exon:109:342108..342506 +
MSAD_210099.t1:cdsCDSMSAD_210099.t1:cds:342108..342506 +
MSAD_210101geneMSAD_210101:352582..354857 +
MSAD_210101.t1mRNAMSAD_210101.t1:352582..354857 +
MSAD_210101.t1:exon:110exonMSAD_210101.t1:exon:110:352582..353076 +
MSAD_210101.t1:exon:111exonMSAD_210101.t1:exon:111:354066..354857 +
MSAD_210101.t1:cdsCDSMSAD_210101.t1:cds:352582..353076 +
MSAD_210101.t1:cdsCDSMSAD_210101.t1:cds:354066..354857 +
MSAD_210100geneMSAD_210100:344930..346487 +
MSAD_210100.t1mRNAMSAD_210100.t1:344930..346487 +
MSAD_210100.t1:exon:112exonMSAD_210100.t1:exon:112:344930..345170 +
MSAD_210100.t1:exon:113exonMSAD_210100.t1:exon:113:345300..345425 +
MSAD_210100.t1:exon:114exonMSAD_210100.t1:exon:114:345979..346487 +
MSAD_210100.t1:cdsCDSMSAD_210100.t1:cds:345039..345170 +
MSAD_210100.t1:cdsCDSMSAD_210100.t1:cds:345300..345425 +
MSAD_210100.t1:cdsCDSMSAD_210100.t1:cds:345979..346269 +
MSAD_210096geneMSAD_210096:318744..320183 +
MSAD_210096.t1mRNAMSAD_210096.t1:318744..320183 +
MSAD_210096.t1:exon:115exonMSAD_210096.t1:exon:115:318744..318748 +
MSAD_210096.t1:exon:116exonMSAD_210096.t1:exon:116:319577..320183 +
MSAD_210096.t1:cdsCDSMSAD_210096.t1:cds:318744..318748 +
MSAD_210096.t1:cdsCDSMSAD_210096.t1:cds:319577..320183 +
MSAD_210104geneMSAD_210104:375150..379148 +
MSAD_210104.t1mRNAMSAD_210104.t1:375150..379148 +
MSAD_210104.t1:exon:117exonMSAD_210104.t1:exon:117:375150..375241 +
MSAD_210104.t1:exon:118exonMSAD_210104.t1:exon:118:375377..375496 +
MSAD_210104.t1:exon:119exonMSAD_210104.t1:exon:119:375635..375772 +
MSAD_210104.t1:exon:120exonMSAD_210104.t1:exon:120:376804..376884 +
MSAD_210104.t1:exon:121exonMSAD_210104.t1:exon:121:377376..377399 +
MSAD_210104.t1:exon:122exonMSAD_210104.t1:exon:122:377534..377741 +
MSAD_210104.t1:exon:123exonMSAD_210104.t1:exon:123:377850..377931 +
MSAD_210104.t1:exon:124exonMSAD_210104.t1:exon:124:378048..378156 +
MSAD_210104.t1:exon:125exonMSAD_210104.t1:exon:125:378341..378457 +
MSAD_210104.t1:exon:126exonMSAD_210104.t1:exon:126:378572..379148 +
MSAD_210104.t1:cdsCDSMSAD_210104.t1:cds:375227..375241 +
MSAD_210104.t1:cdsCDSMSAD_210104.t1:cds:375377..375496 +
MSAD_210104.t1:cdsCDSMSAD_210104.t1:cds:375635..375772 +
MSAD_210104.t1:cdsCDSMSAD_210104.t1:cds:376804..376884 +
MSAD_210104.t1:cdsCDSMSAD_210104.t1:cds:377376..377399 +
MSAD_210104.t1:cdsCDSMSAD_210104.t1:cds:377534..377741 +
MSAD_210104.t1:cdsCDSMSAD_210104.t1:cds:377850..377931 +
MSAD_210104.t1:cdsCDSMSAD_210104.t1:cds:378048..378156 +
MSAD_210104.t1:cdsCDSMSAD_210104.t1:cds:378341..378457 +
MSAD_210104.t1:cdsCDSMSAD_210104.t1:cds:378572..378802 +
MSAD_210097geneMSAD_210097:325905..327182 +
MSAD_210097.t1mRNAMSAD_210097.t1:325905..327182 +
MSAD_210097.t1:exon:127exonMSAD_210097.t1:exon:127:325905..326078 +
MSAD_210097.t1:exon:128exonMSAD_210097.t1:exon:128:326504..327182 +
MSAD_210097.t1:cdsCDSMSAD_210097.t1:cds:325999..326078 +
MSAD_210097.t1:cdsCDSMSAD_210097.t1:cds:326504..326942 +
MSAD_210098geneMSAD_210098:335065..341060 +
MSAD_210098.t1mRNAMSAD_210098.t1:335065..341060 +
MSAD_210098.t1:exon:129exonMSAD_210098.t1:exon:129:335065..335099 +
MSAD_210098.t1:exon:130exonMSAD_210098.t1:exon:130:335741..335863 +
MSAD_210098.t1:exon:131exonMSAD_210098.t1:exon:131:338075..338188 +
MSAD_210098.t1:exon:132exonMSAD_210098.t1:exon:132:338770..338849 +
MSAD_210098.t1:exon:133exonMSAD_210098.t1:exon:133:340044..340168 +
MSAD_210098.t1:exon:134exonMSAD_210098.t1:exon:134:340647..341060 +
MSAD_210098.t1:cdsCDSMSAD_210098.t1:cds:335065..335099 +
MSAD_210098.t1:cdsCDSMSAD_210098.t1:cds:335741..335863 +
MSAD_210098.t1:cdsCDSMSAD_210098.t1:cds:338075..338188 +
MSAD_210098.t1:cdsCDSMSAD_210098.t1:cds:338770..338849 +
MSAD_210098.t1:cdsCDSMSAD_210098.t1:cds:340044..340168 +
MSAD_210098.t1:cdsCDSMSAD_210098.t1:cds:340647..340718 +
MSAD_210092geneMSAD_210092:290023..291274 -
MSAD_210092.t1mRNAMSAD_210092.t1:290023..291274 -
MSAD_210092.t1:exon:141exonMSAD_210092.t1:exon:141:290023..290596 -
MSAD_210092.t1:exon:140exonMSAD_210092.t1:exon:140:290963..291274 -
MSAD_210092.t1:cdsCDSMSAD_210092.t1:cds:290963..291131 -
MSAD_210092.t1:cdsCDSMSAD_210092.t1:cds:290358..290596 -
MSAD_210094geneMSAD_210094:300240..310763 -
MSAD_210094.t1mRNAMSAD_210094.t1:300240..310763 -
MSAD_210094.t1:exon:151exonMSAD_210094.t1:exon:151:300240..300816 -
MSAD_210094.t1:exon:150exonMSAD_210094.t1:exon:150:301044..301151 -
MSAD_210094.t1:exon:149exonMSAD_210094.t1:exon:149:301261..301595 -
MSAD_210094.t1:exon:148exonMSAD_210094.t1:exon:148:303822..303932 -
MSAD_210094.t1:exon:147exonMSAD_210094.t1:exon:147:304112..304303 -
MSAD_210094.t1:exon:146exonMSAD_210094.t1:exon:146:305252..305356 -
MSAD_210094.t1:exon:145exonMSAD_210094.t1:exon:145:305967..306367 -
MSAD_210094.t1:exon:144exonMSAD_210094.t1:exon:144:306837..308739 -
MSAD_210094.t1:exon:143exonMSAD_210094.t1:exon:143:310457..310556 -
MSAD_210094.t1:exon:142exonMSAD_210094.t1:exon:142:310664..310763 -
MSAD_210094.t1:cdsCDSMSAD_210094.t1:cds:310457..310549 -
MSAD_210094.t1:cdsCDSMSAD_210094.t1:cds:306837..308739 -
MSAD_210094.t1:cdsCDSMSAD_210094.t1:cds:305967..306367 -
MSAD_210094.t1:cdsCDSMSAD_210094.t1:cds:305252..305356 -
MSAD_210094.t1:cdsCDSMSAD_210094.t1:cds:304112..304303 -
MSAD_210094.t1:cdsCDSMSAD_210094.t1:cds:303822..303932 -
MSAD_210094.t1:cdsCDSMSAD_210094.t1:cds:301515..301595 -
MSAD_210102geneMSAD_210102:355547..364996 -
MSAD_210102.t1mRNAMSAD_210102.t1:355547..364996 -
MSAD_210102.t1:exon:159exonMSAD_210102.t1:exon:159:355547..356028 -
MSAD_210102.t1:exon:158exonMSAD_210102.t1:exon:158:358436..360768 -
MSAD_210102.t1:exon:157exonMSAD_210102.t1:exon:157:361220..361514 -
MSAD_210102.t1:exon:156exonMSAD_210102.t1:exon:156:363013..363037 -
MSAD_210102.t1:exon:155exonMSAD_210102.t1:exon:155:363850..364138 -
MSAD_210102.t1:exon:154exonMSAD_210102.t1:exon:154:364266..364361 -
MSAD_210102.t1:exon:153exonMSAD_210102.t1:exon:153:364569..364762 -
MSAD_210102.t1:exon:152exonMSAD_210102.t1:exon:152:364850..364996 -
MSAD_210102.t1:cdsCDSMSAD_210102.t1:cds:364569..364737 -
MSAD_210102.t1:cdsCDSMSAD_210102.t1:cds:364266..364361 -
MSAD_210102.t1:cdsCDSMSAD_210102.t1:cds:363850..364138 -
MSAD_210102.t1:cdsCDSMSAD_210102.t1:cds:363013..363037 -
MSAD_210102.t1:cdsCDSMSAD_210102.t1:cds:361220..361514 -
MSAD_210102.t1:cdsCDSMSAD_210102.t1:cds:360473..360768 -
MSAD_210093geneMSAD_210093:293410..298694 -
MSAD_210093.t1mRNAMSAD_210093.t1:293410..298694 -
MSAD_210093.t1:exon:167exonMSAD_210093.t1:exon:167:298597..298694 -
MSAD_210093.t1:exon:166exonMSAD_210093.t1:exon:166:297720..297743 -
MSAD_210093.t1:exon:165exonMSAD_210093.t1:exon:165:294630..294930 -
MSAD_210093.t1:exon:164exonMSAD_210093.t1:exon:164:294361..294549 -
MSAD_210093.t1:exon:163exonMSAD_210093.t1:exon:163:294228..294284 -
MSAD_210093.t1:exon:162exonMSAD_210093.t1:exon:162:294091..294131 -
MSAD_210093.t1:exon:161exonMSAD_210093.t1:exon:161:293649..293755 -
MSAD_210093.t1:exon:160exonMSAD_210093.t1:exon:160:293410..293630 -
MSAD_210093.t1:cdsCDSMSAD_210093.t1:cds:298597..298694 -
MSAD_210093.t1:cdsCDSMSAD_210093.t1:cds:297720..297743 -
MSAD_210093.t1:cdsCDSMSAD_210093.t1:cds:294630..294930 -
MSAD_210093.t1:cdsCDSMSAD_210093.t1:cds:294361..294549 -
MSAD_210093.t1:cdsCDSMSAD_210093.t1:cds:294228..294284 -
MSAD_210093.t1:cdsCDSMSAD_210093.t1:cds:294091..294131 -
MSAD_210093.t1:cdsCDSMSAD_210093.t1:cds:293649..293755 -
MSAD_210093.t1:cdsCDSMSAD_210093.t1:cds:293410..293630 -
MSAD_210103geneMSAD_210103:368283..368615 -
MSAD_210103.t1mRNAMSAD_210103.t1:368283..368615 -
MSAD_210103.t1:exon:168exonMSAD_210103.t1:exon:168:368283..368615 -
MSAD_210103.t1:cdsCDSMSAD_210103.t1:cds:368283..368615 -
MSAD_210107geneMSAD_210107:392625..396181 +
MSAD_210107.t1mRNAMSAD_210107.t1:392625..396181 +
MSAD_210107.t1:exon:169exonMSAD_210107.t1:exon:169:392625..392937 +
MSAD_210107.t1:exon:170exonMSAD_210107.t1:exon:170:393480..393643 +
MSAD_210107.t1:exon:171exonMSAD_210107.t1:exon:171:393751..393929 +
MSAD_210107.t1:exon:172exonMSAD_210107.t1:exon:172:394285..394541 +
MSAD_210107.t1:exon:173exonMSAD_210107.t1:exon:173:394847..396181 +
MSAD_210107.t1:cdsCDSMSAD_210107.t1:cds:392666..392937 +
MSAD_210107.t1:cdsCDSMSAD_210107.t1:cds:393480..393643 +
MSAD_210107.t1:cdsCDSMSAD_210107.t1:cds:393751..393929 +
MSAD_210107.t1:cdsCDSMSAD_210107.t1:cds:394285..394541 +
MSAD_210107.t1:cdsCDSMSAD_210107.t1:cds:394847..394925 +
MSAD_210115geneMSAD_210115:433445..435912 +
MSAD_210115.t1mRNAMSAD_210115.t1:433445..435912 +
MSAD_210115.t1:exon:174exonMSAD_210115.t1:exon:174:433445..434114 +
MSAD_210115.t1:exon:175exonMSAD_210115.t1:exon:175:434165..435912 +
MSAD_210115.t1:cdsCDSMSAD_210115.t1:cds:433445..434114 +
MSAD_210115.t1:cdsCDSMSAD_210115.t1:cds:434165..435912 +
MSAD_210110geneMSAD_210110:401937..405380 +
MSAD_210110.t1mRNAMSAD_210110.t1:401937..405380 +
MSAD_210110.t1:exon:176exonMSAD_210110.t1:exon:176:401937..402057 +
MSAD_210110.t1:exon:177exonMSAD_210110.t1:exon:177:402242..402362 +
MSAD_210110.t1:exon:178exonMSAD_210110.t1:exon:178:403118..403228 +
MSAD_210110.t1:exon:179exonMSAD_210110.t1:exon:179:403392..403462 +
MSAD_210110.t1:exon:180exonMSAD_210110.t1:exon:180:403610..403645 +
MSAD_210110.t1:exon:181exonMSAD_210110.t1:exon:181:404271..404316 +
MSAD_210110.t1:exon:182exonMSAD_210110.t1:exon:182:404491..404578 +
MSAD_210110.t1:exon:183exonMSAD_210110.t1:exon:183:404879..404936 +
MSAD_210110.t1:exon:184exonMSAD_210110.t1:exon:184:405188..405380 +
MSAD_210110.t1:cdsCDSMSAD_210110.t1:cds:401962..402057 +
MSAD_210110.t1:cdsCDSMSAD_210110.t1:cds:402242..402362 +
MSAD_210110.t1:cdsCDSMSAD_210110.t1:cds:403118..403228 +
MSAD_210110.t1:cdsCDSMSAD_210110.t1:cds:403392..403462 +
MSAD_210110.t1:cdsCDSMSAD_210110.t1:cds:403610..403645 +
MSAD_210110.t1:cdsCDSMSAD_210110.t1:cds:404271..404316 +
MSAD_210110.t1:cdsCDSMSAD_210110.t1:cds:404491..404578 +
MSAD_210110.t1:cdsCDSMSAD_210110.t1:cds:404879..404936 +
MSAD_210110.t1:cdsCDSMSAD_210110.t1:cds:405188..405238 +
MSAD_210112geneMSAD_210112:417420..418739 +
MSAD_210112.t1mRNAMSAD_210112.t1:417420..418739 +
MSAD_210112.t1:exon:185exonMSAD_210112.t1:exon:185:417420..418739 +
MSAD_210112.t1:cdsCDSMSAD_210112.t1:cds:417420..418739 +
MSAD_210121geneMSAD_210121:469363..469677 +
MSAD_210121.t1mRNAMSAD_210121.t1:469363..469677 +
MSAD_210121.t1:exon:186exonMSAD_210121.t1:exon:186:469363..469677 +
MSAD_210121.t1:cdsCDSMSAD_210121.t1:cds:469363..469677 +
MSAD_210120geneMSAD_210120:464134..466318 +
MSAD_210120.t1mRNAMSAD_210120.t1:464134..466318 +
MSAD_210120.t1:exon:187exonMSAD_210120.t1:exon:187:464134..464288 +
MSAD_210120.t1:exon:188exonMSAD_210120.t1:exon:188:464389..464530 +
MSAD_210120.t1:exon:189exonMSAD_210120.t1:exon:189:466064..466318 +
MSAD_210120.t1:cdsCDSMSAD_210120.t1:cds:464134..464288 +
MSAD_210120.t1:cdsCDSMSAD_210120.t1:cds:464389..464530 +
MSAD_210120.t1:cdsCDSMSAD_210120.t1:cds:466064..466318 +
MSAD_210119geneMSAD_210119:456864..457106 +
MSAD_210119.t1mRNAMSAD_210119.t1:456864..457106 +
MSAD_210119.t1:exon:190exonMSAD_210119.t1:exon:190:456864..457106 +
MSAD_210119.t1:cdsCDSMSAD_210119.t1:cds:456864..457106 +
MSAD_210118geneMSAD_210118:456231..456663 +
MSAD_210118.t1mRNAMSAD_210118.t1:456231..456663 +
MSAD_210118.t1:exon:191exonMSAD_210118.t1:exon:191:456231..456385 +
MSAD_210118.t1:exon:192exonMSAD_210118.t1:exon:192:456528..456663 +
MSAD_210118.t1:cdsCDSMSAD_210118.t1:cds:456231..456385 +
MSAD_210118.t1:cdsCDSMSAD_210118.t1:cds:456528..456663 +
MSAD_210122geneMSAD_210122:478825..479115 -
MSAD_210122.t1mRNAMSAD_210122.t1:478825..479115 -
MSAD_210122.t1:exon:193exonMSAD_210122.t1:exon:193:478825..479115 -
MSAD_210122.t1:cdsCDSMSAD_210122.t1:cds:478825..479115 -
MSAD_210108geneMSAD_210108:395622..398675 -
MSAD_210108.t1mRNAMSAD_210108.t1:395622..398675 -
MSAD_210108.t1:exon:198exonMSAD_210108.t1:exon:198:395622..395986 -
MSAD_210108.t1:exon:197exonMSAD_210108.t1:exon:197:396082..396174 -
MSAD_210108.t1:exon:196exonMSAD_210108.t1:exon:196:396655..396762 -
MSAD_210108.t1:exon:195exonMSAD_210108.t1:exon:195:398264..398321 -
MSAD_210108.t1:exon:194exonMSAD_210108.t1:exon:194:398419..398675 -
MSAD_210108.t1:cdsCDSMSAD_210108.t1:cds:398419..398611 -
MSAD_210108.t1:cdsCDSMSAD_210108.t1:cds:398264..398321 -
MSAD_210108.t1:cdsCDSMSAD_210108.t1:cds:396655..396762 -
MSAD_210108.t1:cdsCDSMSAD_210108.t1:cds:396082..396174 -
MSAD_210108.t1:cdsCDSMSAD_210108.t1:cds:395905..395986 -
MSAD_210116geneMSAD_210116:438009..443504 -
MSAD_210116.t1mRNAMSAD_210116.t1:438009..443504 -
MSAD_210116.t1:exon:208exonMSAD_210116.t1:exon:208:438009..438807 -
MSAD_210116.t1:exon:207exonMSAD_210116.t1:exon:207:439016..439302 -
MSAD_210116.t1:exon:206exonMSAD_210116.t1:exon:206:439604..439838 -
MSAD_210116.t1:exon:205exonMSAD_210116.t1:exon:205:440999..441208 -
MSAD_210116.t1:exon:204exonMSAD_210116.t1:exon:204:441321..441371 -
MSAD_210116.t1:exon:203exonMSAD_210116.t1:exon:203:441462..441597 -
MSAD_210116.t1:exon:202exonMSAD_210116.t1:exon:202:441955..442055 -
MSAD_210116.t1:exon:201exonMSAD_210116.t1:exon:201:442264..442434 -
MSAD_210116.t1:exon:200exonMSAD_210116.t1:exon:200:442538..442635 -
MSAD_210116.t1:exon:199exonMSAD_210116.t1:exon:199:443189..443504 -
MSAD_210116.t1:cdsCDSMSAD_210116.t1:cds:443189..443504 -
MSAD_210116.t1:cdsCDSMSAD_210116.t1:cds:442538..442635 -
MSAD_210116.t1:cdsCDSMSAD_210116.t1:cds:442264..442434 -
MSAD_210116.t1:cdsCDSMSAD_210116.t1:cds:441955..442055 -
MSAD_210116.t1:cdsCDSMSAD_210116.t1:cds:441462..441597 -
MSAD_210116.t1:cdsCDSMSAD_210116.t1:cds:441321..441371 -
MSAD_210116.t1:cdsCDSMSAD_210116.t1:cds:440999..441208 -
MSAD_210116.t1:cdsCDSMSAD_210116.t1:cds:439604..439838 -
MSAD_210116.t1:cdsCDSMSAD_210116.t1:cds:439016..439302 -
MSAD_210116.t1:cdsCDSMSAD_210116.t1:cds:438586..438807 -
MSAD_210111geneMSAD_210111:406465..413625 -
MSAD_210111.t1mRNAMSAD_210111.t1:406465..413625 -
MSAD_210111.t1:exon:220exonMSAD_210111.t1:exon:220:406465..406943 -
MSAD_210111.t1:exon:219exonMSAD_210111.t1:exon:219:407498..407631 -
MSAD_210111.t1:exon:218exonMSAD_210111.t1:exon:218:408450..408564 -
MSAD_210111.t1:exon:217exonMSAD_210111.t1:exon:217:408680..408817 -
MSAD_210111.t1:exon:216exonMSAD_210111.t1:exon:216:408904..408996 -
MSAD_210111.t1:exon:215exonMSAD_210111.t1:exon:215:409082..409169 -
MSAD_210111.t1:exon:214exonMSAD_210111.t1:exon:214:410690..410787 -
MSAD_210111.t1:exon:213exonMSAD_210111.t1:exon:213:410883..411001 -
MSAD_210111.t1:exon:212exonMSAD_210111.t1:exon:212:411464..411573 -
MSAD_210111.t1:exon:211exonMSAD_210111.t1:exon:211:412261..412335 -
MSAD_210111.t1:exon:210exonMSAD_210111.t1:exon:210:412448..412537 -
MSAD_210111.t1:exon:209exonMSAD_210111.t1:exon:209:413525..413625 -
MSAD_210111.t1:cdsCDSMSAD_210111.t1:cds:413525..413625 -
MSAD_210111.t1:cdsCDSMSAD_210111.t1:cds:412448..412537 -
MSAD_210111.t1:cdsCDSMSAD_210111.t1:cds:412261..412335 -
MSAD_210111.t1:cdsCDSMSAD_210111.t1:cds:411464..411573 -
MSAD_210111.t1:cdsCDSMSAD_210111.t1:cds:410883..411001 -
MSAD_210111.t1:cdsCDSMSAD_210111.t1:cds:410690..410787 -
MSAD_210111.t1:cdsCDSMSAD_210111.t1:cds:409082..409169 -
MSAD_210111.t1:cdsCDSMSAD_210111.t1:cds:408904..408996 -
MSAD_210111.t1:cdsCDSMSAD_210111.t1:cds:408680..408817 -
MSAD_210111.t1:cdsCDSMSAD_210111.t1:cds:408450..408564 -
MSAD_210111.t1:cdsCDSMSAD_210111.t1:cds:407498..407631 -
MSAD_210111.t1:cdsCDSMSAD_210111.t1:cds:406899..406943 -
MSAD_210117geneMSAD_210117:447529..449957 -
MSAD_210117.t1mRNAMSAD_210117.t1:447529..449957 -
MSAD_210117.t1:exon:225exonMSAD_210117.t1:exon:225:447529..447797 -
MSAD_210117.t1:exon:224exonMSAD_210117.t1:exon:224:448012..448076 -
MSAD_210117.t1:exon:223exonMSAD_210117.t1:exon:223:448183..448245 -
MSAD_210117.t1:exon:222exonMSAD_210117.t1:exon:222:449456..449502 -
MSAD_210117.t1:exon:221exonMSAD_210117.t1:exon:221:449617..449957 -
MSAD_210117.t1:cdsCDSMSAD_210117.t1:cds:449617..449744 -
MSAD_210117.t1:cdsCDSMSAD_210117.t1:cds:449456..449502 -
MSAD_210117.t1:cdsCDSMSAD_210117.t1:cds:448183..448245 -
MSAD_210117.t1:cdsCDSMSAD_210117.t1:cds:448012..448076 -
MSAD_210117.t1:cdsCDSMSAD_210117.t1:cds:447696..447797 -
MSAD_210106geneMSAD_210106:388992..390534 -
MSAD_210106.t1mRNAMSAD_210106.t1:388992..390534 -
MSAD_210106.t1:exon:227exonMSAD_210106.t1:exon:227:389778..390534 -
MSAD_210106.t1:exon:226exonMSAD_210106.t1:exon:226:388992..389470 -
MSAD_210106.t1:cdsCDSMSAD_210106.t1:cds:389778..390534 -
MSAD_210106.t1:cdsCDSMSAD_210106.t1:cds:388992..389470 -
MSAD_210105geneMSAD_210105:380023..381618 -
MSAD_210105.t1mRNAMSAD_210105.t1:380023..381618 -
MSAD_210105.t1:exon:229exonMSAD_210105.t1:exon:229:380868..381618 -
MSAD_210105.t1:exon:228exonMSAD_210105.t1:exon:228:380023..380507 -
MSAD_210105.t1:cdsCDSMSAD_210105.t1:cds:380868..381618 -
MSAD_210105.t1:cdsCDSMSAD_210105.t1:cds:380023..380507 -
MSAD_210109geneMSAD_210109:400120..402041 -
MSAD_210109.t1mRNAMSAD_210109.t1:400120..402041 -
MSAD_210109.t1:exon:237exonMSAD_210109.t1:exon:237:401980..402041 -
MSAD_210109.t1:exon:236exonMSAD_210109.t1:exon:236:401372..401624 -
MSAD_210109.t1:exon:235exonMSAD_210109.t1:exon:235:400960..401253 -
MSAD_210109.t1:exon:234exonMSAD_210109.t1:exon:234:400772..400864 -
MSAD_210109.t1:exon:233exonMSAD_210109.t1:exon:233:400591..400746 -
MSAD_210109.t1:exon:232exonMSAD_210109.t1:exon:232:400468..400548 -
MSAD_210109.t1:exon:231exonMSAD_210109.t1:exon:231:400343..400448 -
MSAD_210109.t1:exon:230exonMSAD_210109.t1:exon:230:400120..400202 -
MSAD_210109.t1:cdsCDSMSAD_210109.t1:cds:401980..402041 -
MSAD_210109.t1:cdsCDSMSAD_210109.t1:cds:401372..401624 -
MSAD_210109.t1:cdsCDSMSAD_210109.t1:cds:400960..401253 -
MSAD_210109.t1:cdsCDSMSAD_210109.t1:cds:400772..400864 -
MSAD_210109.t1:cdsCDSMSAD_210109.t1:cds:400591..400746 -
MSAD_210109.t1:cdsCDSMSAD_210109.t1:cds:400468..400548 -
MSAD_210109.t1:cdsCDSMSAD_210109.t1:cds:400343..400448 -
MSAD_210109.t1:cdsCDSMSAD_210109.t1:cds:400120..400202 -
MSAD_210114geneMSAD_210114:427108..430873 -
MSAD_210114.t1mRNAMSAD_210114.t1:427108..430873 -
MSAD_210114.t1:exon:243exonMSAD_210114.t1:exon:243:430020..430873 -
MSAD_210114.t1:exon:242exonMSAD_210114.t1:exon:242:427108..427114 -
MSAD_210114.t1:cdsCDSMSAD_210114.t1:cds:430020..430873 -
MSAD_210114.t1:cdsCDSMSAD_210114.t1:cds:427108..427114 -
MSAD_210128geneMSAD_210128:565480..568015 +
MSAD_210128.t1mRNAMSAD_210128.t1:565480..568015 +
MSAD_210128.t1:exon:244exonMSAD_210128.t1:exon:244:565480..565684 +
MSAD_210128.t1:exon:245exonMSAD_210128.t1:exon:245:566673..566878 +
MSAD_210128.t1:exon:246exonMSAD_210128.t1:exon:246:567413..568015 +
MSAD_210128.t1:cdsCDSMSAD_210128.t1:cds:565595..565684 +
MSAD_210128.t1:cdsCDSMSAD_210128.t1:cds:566673..566878 +
MSAD_210128.t1:cdsCDSMSAD_210128.t1:cds:567413..567677 +
MSAD_210129geneMSAD_210129:571230..573810 +
MSAD_210129.t1mRNAMSAD_210129.t1:571230..573810 +
MSAD_210129.t1:exon:247exonMSAD_210129.t1:exon:247:571230..571578 +
MSAD_210129.t1:exon:248exonMSAD_210129.t1:exon:248:571611..571753 +
MSAD_210129.t1:exon:249exonMSAD_210129.t1:exon:249:573145..573810 +
MSAD_210129.t1:cdsCDSMSAD_210129.t1:cds:571230..571578 +
MSAD_210129.t1:cdsCDSMSAD_210129.t1:cds:571611..571753 +
MSAD_210129.t1:cdsCDSMSAD_210129.t1:cds:573145..573810 +
MSAD_210127geneMSAD_210127:552015..558451 +
MSAD_210127.t1mRNAMSAD_210127.t1:552015..558451 +
MSAD_210127.t1:exon:250exonMSAD_210127.t1:exon:250:552015..552962 +
MSAD_210127.t1:exon:251exonMSAD_210127.t1:exon:251:553044..553220 +
MSAD_210127.t1:exon:252exonMSAD_210127.t1:exon:252:553767..553870 +
MSAD_210127.t1:exon:253exonMSAD_210127.t1:exon:253:554135..554213 +
MSAD_210127.t1:exon:254exonMSAD_210127.t1:exon:254:554313..554465 +
MSAD_210127.t1:exon:255exonMSAD_210127.t1:exon:255:554554..554783 +
MSAD_210127.t1:exon:256exonMSAD_210127.t1:exon:256:555199..556760 +
MSAD_210127.t1:exon:257exonMSAD_210127.t1:exon:257:556902..558451 +
MSAD_210127.t1:cdsCDSMSAD_210127.t1:cds:552904..552962 +
MSAD_210127.t1:cdsCDSMSAD_210127.t1:cds:553044..553220 +
MSAD_210127.t1:cdsCDSMSAD_210127.t1:cds:553767..553870 +
MSAD_210127.t1:cdsCDSMSAD_210127.t1:cds:554135..554213 +
MSAD_210127.t1:cdsCDSMSAD_210127.t1:cds:554313..554465 +
MSAD_210127.t1:cdsCDSMSAD_210127.t1:cds:554554..554783 +
MSAD_210127.t1:cdsCDSMSAD_210127.t1:cds:555199..556760 +
MSAD_210127.t1:cdsCDSMSAD_210127.t1:cds:556902..557873 +
MSAD_210123geneMSAD_210123:483531..488511 +
MSAD_210123.t1mRNAMSAD_210123.t1:483531..488511 +
MSAD_210123.t1:exon:258exonMSAD_210123.t1:exon:258:483531..484150 +
MSAD_210123.t1:exon:259exonMSAD_210123.t1:exon:259:485348..485437 +
MSAD_210123.t1:exon:260exonMSAD_210123.t1:exon:260:486305..486372 +
MSAD_210123.t1:exon:261exonMSAD_210123.t1:exon:261:488030..488511 +
MSAD_210123.t1:cdsCDSMSAD_210123.t1:cds:483749..484150 +
MSAD_210123.t1:cdsCDSMSAD_210123.t1:cds:485348..485437 +
MSAD_210123.t1:cdsCDSMSAD_210123.t1:cds:486305..486372 +
MSAD_210123.t1:cdsCDSMSAD_210123.t1:cds:488030..488273 +
MSAD_210130geneMSAD_210130:576289..578825 +
MSAD_210130.t1mRNAMSAD_210130.t1:576289..578825 +
MSAD_210130.t1:exon:262exonMSAD_210130.t1:exon:262:576289..576540 +
MSAD_210130.t1:exon:263exonMSAD_210130.t1:exon:263:576671..576787 +
MSAD_210130.t1:exon:264exonMSAD_210130.t1:exon:264:577525..577590 +
MSAD_210130.t1:exon:265exonMSAD_210130.t1:exon:265:577714..577817 +
MSAD_210130.t1:exon:266exonMSAD_210130.t1:exon:266:578238..578443 +
MSAD_210130.t1:exon:267exonMSAD_210130.t1:exon:267:578526..578572 +
MSAD_210130.t1:exon:268exonMSAD_210130.t1:exon:268:578757..578825 +
MSAD_210130.t1:cdsCDSMSAD_210130.t1:cds:576289..576540 +
MSAD_210130.t1:cdsCDSMSAD_210130.t1:cds:576671..576787 +
MSAD_210130.t1:cdsCDSMSAD_210130.t1:cds:577525..577590 +
MSAD_210130.t1:cdsCDSMSAD_210130.t1:cds:577714..577817 +
MSAD_210130.t1:cdsCDSMSAD_210130.t1:cds:578238..578443 +
MSAD_210130.t1:cdsCDSMSAD_210130.t1:cds:578526..578572 +
MSAD_210130.t1:cdsCDSMSAD_210130.t1:cds:578757..578825 +
MSAD_210126geneMSAD_210126:523464..524928 -
MSAD_210126.t1mRNAMSAD_210126.t1:523464..524928 -
MSAD_210126.t1:exon:270exonMSAD_210126.t1:exon:270:523464..523785 -
MSAD_210126.t1:exon:269exonMSAD_210126.t1:exon:269:524266..524928 -
MSAD_210126.t1:cdsCDSMSAD_210126.t1:cds:524266..524750 -
MSAD_210126.t1:cdsCDSMSAD_210126.t1:cds:523641..523785 -
MSAD_210125geneMSAD_210125:496963..497319 -
MSAD_210125.t1mRNAMSAD_210125.t1:496963..497319 -
MSAD_210125.t1:exon:271exonMSAD_210125.t1:exon:271:496963..497319 -
MSAD_210125.t1:cdsCDSMSAD_210125.t1:cds:496963..497319 -
MSAD_210124geneMSAD_210124:489527..493100 -
MSAD_210124.t1mRNAMSAD_210124.t1:489527..493100 -
MSAD_210124.t1:exon:278exonMSAD_210124.t1:exon:278:489527..490654 -
MSAD_210124.t1:exon:277exonMSAD_210124.t1:exon:277:490743..490824 -
MSAD_210124.t1:exon:276exonMSAD_210124.t1:exon:276:491597..491804 -
MSAD_210124.t1:exon:275exonMSAD_210124.t1:exon:275:491912..491932 -
MSAD_210124.t1:exon:274exonMSAD_210124.t1:exon:274:492026..492196 -
MSAD_210124.t1:exon:273exonMSAD_210124.t1:exon:273:492316..492447 -
MSAD_210124.t1:exon:272exonMSAD_210124.t1:exon:272:492808..493100 -
MSAD_210124.t1:cdsCDSMSAD_210124.t1:cds:492808..493038 -
MSAD_210124.t1:cdsCDSMSAD_210124.t1:cds:492316..492447 -
MSAD_210124.t1:cdsCDSMSAD_210124.t1:cds:492026..492196 -
MSAD_210124.t1:cdsCDSMSAD_210124.t1:cds:491912..491932 -
MSAD_210124.t1:cdsCDSMSAD_210124.t1:cds:491597..491804 -
MSAD_210124.t1:cdsCDSMSAD_210124.t1:cds:490743..490824 -
MSAD_210124.t1:cdsCDSMSAD_210124.t1:cds:490255..490654 -
MSAD_210134geneMSAD_210134:648840..654863 +
MSAD_210134.t1mRNAMSAD_210134.t1:648840..654863 +
MSAD_210134.t1:exon:279exonMSAD_210134.t1:exon:279:648840..650639 +
MSAD_210134.t1:exon:280exonMSAD_210134.t1:exon:280:652250..652340 +
MSAD_210134.t1:exon:281exonMSAD_210134.t1:exon:281:652772..652929 +
MSAD_210134.t1:exon:282exonMSAD_210134.t1:exon:282:653013..653064 +
MSAD_210134.t1:exon:283exonMSAD_210134.t1:exon:283:653177..653259 +
MSAD_210134.t1:exon:284exonMSAD_210134.t1:exon:284:653342..653435 +
MSAD_210134.t1:exon:285exonMSAD_210134.t1:exon:285:653577..654863 +
MSAD_210134.t1:cdsCDSMSAD_210134.t1:cds:649164..650639 +
MSAD_210134.t1:cdsCDSMSAD_210134.t1:cds:652250..652340 +
MSAD_210134.t1:cdsCDSMSAD_210134.t1:cds:652772..652929 +
MSAD_210134.t1:cdsCDSMSAD_210134.t1:cds:653013..653064 +
MSAD_210134.t1:cdsCDSMSAD_210134.t1:cds:653177..653259 +
MSAD_210134.t1:cdsCDSMSAD_210134.t1:cds:653342..653435 +
MSAD_210134.t1:cdsCDSMSAD_210134.t1:cds:653577..654172 +
MSAD_210137geneMSAD_210137:660093..663054 +
MSAD_210137.t1mRNAMSAD_210137.t1:660093..663054 +
MSAD_210137.t1:exon:286exonMSAD_210137.t1:exon:286:660093..660374 +
MSAD_210137.t1:exon:287exonMSAD_210137.t1:exon:287:660469..660567 +
MSAD_210137.t1:exon:288exonMSAD_210137.t1:exon:288:661174..661705 +
MSAD_210137.t1:exon:289exonMSAD_210137.t1:exon:289:661905..662263 +
MSAD_210137.t1:exon:290exonMSAD_210137.t1:exon:290:662591..663054 +
MSAD_210137.t1:cdsCDSMSAD_210137.t1:cds:660321..660374 +
MSAD_210137.t1:cdsCDSMSAD_210137.t1:cds:660469..660567 +
MSAD_210137.t1:cdsCDSMSAD_210137.t1:cds:661174..661705 +
MSAD_210137.t1:cdsCDSMSAD_210137.t1:cds:661905..662263 +
MSAD_210137.t1:cdsCDSMSAD_210137.t1:cds:662591..662746 +
MSAD_210131geneMSAD_210131:586917..591600 +
MSAD_210131.t1mRNAMSAD_210131.t1:586917..591600 +
MSAD_210131.t1:exon:291exonMSAD_210131.t1:exon:291:586917..587465 +
MSAD_210131.t1:exon:292exonMSAD_210131.t1:exon:292:590148..590269 +
MSAD_210131.t1:exon:293exonMSAD_210131.t1:exon:293:590455..590674 +
MSAD_210131.t1:exon:294exonMSAD_210131.t1:exon:294:590973..591034 +
MSAD_210131.t1:exon:295exonMSAD_210131.t1:exon:295:591129..591600 +
MSAD_210131.t1:cdsCDSMSAD_210131.t1:cds:587103..587465 +
MSAD_210131.t1:cdsCDSMSAD_210131.t1:cds:590148..590269 +
MSAD_210131.t1:cdsCDSMSAD_210131.t1:cds:590455..590674 +
MSAD_210131.t1:cdsCDSMSAD_210131.t1:cds:590973..591034 +
MSAD_210131.t1:cdsCDSMSAD_210131.t1:cds:591129..591228 +
MSAD_210135geneMSAD_210135:656505..657560 +
MSAD_210135.t1mRNAMSAD_210135.t1:656505..657560 +
MSAD_210135.t1:exon:296exonMSAD_210135.t1:exon:296:656505..656853 +
MSAD_210135.t1:exon:297exonMSAD_210135.t1:exon:297:656995..657280 +
MSAD_210135.t1:exon:298exonMSAD_210135.t1:exon:298:657290..657560 +
MSAD_210135.t1:cdsCDSMSAD_210135.t1:cds:656505..656853 +
MSAD_210135.t1:cdsCDSMSAD_210135.t1:cds:656995..657280 +
MSAD_210135.t1:cdsCDSMSAD_210135.t1:cds:657290..657560 +
MSAD_210138geneMSAD_210138:663440..666803 -
MSAD_210138.t1mRNAMSAD_210138.t1:663440..666803 -
MSAD_210138.t1:exon:304exonMSAD_210138.t1:exon:304:663440..664182 -
MSAD_210138.t1:exon:303exonMSAD_210138.t1:exon:303:664421..664735 -
MSAD_210138.t1:exon:302exonMSAD_210138.t1:exon:302:664839..664955 -
MSAD_210138.t1:exon:301exonMSAD_210138.t1:exon:301:665066..665177 -
MSAD_210138.t1:exon:300exonMSAD_210138.t1:exon:300:665931..666109 -
MSAD_210138.t1:exon:299exonMSAD_210138.t1:exon:299:666529..666803 -
MSAD_210138.t1:cdsCDSMSAD_210138.t1:cds:666529..666714 -
MSAD_210138.t1:cdsCDSMSAD_210138.t1:cds:665931..666109 -
MSAD_210138.t1:cdsCDSMSAD_210138.t1:cds:665066..665177 -
MSAD_210138.t1:cdsCDSMSAD_210138.t1:cds:664839..664955 -
MSAD_210138.t1:cdsCDSMSAD_210138.t1:cds:664421..664735 -
MSAD_210138.t1:cdsCDSMSAD_210138.t1:cds:663844..664182 -
MSAD_210139geneMSAD_210139:668924..673874 -
MSAD_210139.t1mRNAMSAD_210139.t1:668924..673874 -
MSAD_210139.t1:exon:309exonMSAD_210139.t1:exon:309:668924..669550 -
MSAD_210139.t1:exon:308exonMSAD_210139.t1:exon:308:669942..670062 -
MSAD_210139.t1:exon:307exonMSAD_210139.t1:exon:307:670168..670408 -
MSAD_210139.t1:exon:306exonMSAD_210139.t1:exon:306:670843..671254 -
MSAD_210139.t1:exon:305exonMSAD_210139.t1:exon:305:673276..673874 -
MSAD_210139.t1:cdsCDSMSAD_210139.t1:cds:670843..671051 -
MSAD_210139.t1:cdsCDSMSAD_210139.t1:cds:670168..670408 -
MSAD_210139.t1:cdsCDSMSAD_210139.t1:cds:669942..670062 -
MSAD_210139.t1:cdsCDSMSAD_210139.t1:cds:669360..669550 -
MSAD_210133geneMSAD_210133:628543..629286 -
MSAD_210133.t1mRNAMSAD_210133.t1:628543..629286 -
MSAD_210133.t1:exon:312exonMSAD_210133.t1:exon:312:629147..629286 -
MSAD_210133.t1:exon:311exonMSAD_210133.t1:exon:311:628858..629070 -
MSAD_210133.t1:exon:310exonMSAD_210133.t1:exon:310:628543..628720 -
MSAD_210133.t1:cdsCDSMSAD_210133.t1:cds:629147..629286 -
MSAD_210133.t1:cdsCDSMSAD_210133.t1:cds:628858..629070 -
MSAD_210133.t1:cdsCDSMSAD_210133.t1:cds:628543..628720 -
MSAD_210132geneMSAD_210132:627551..628532 -
MSAD_210132.t1mRNAMSAD_210132.t1:627551..628532 -
MSAD_210132.t1:exon:315exonMSAD_210132.t1:exon:315:628475..628532 -
MSAD_210132.t1:exon:314exonMSAD_210132.t1:exon:314:627777..627835 -
MSAD_210132.t1:exon:313exonMSAD_210132.t1:exon:313:627551..627751 -
MSAD_210132.t1:cdsCDSMSAD_210132.t1:cds:628475..628532 -
MSAD_210132.t1:cdsCDSMSAD_210132.t1:cds:627777..627835 -
MSAD_210132.t1:cdsCDSMSAD_210132.t1:cds:627551..627751 -
MSAD_210141geneMSAD_210141:738989..741545 +
MSAD_210141.t1mRNAMSAD_210141.t1:738989..741545 +
MSAD_210141.t1:exon:319exonMSAD_210141.t1:exon:319:738989..739390 +
MSAD_210141.t1:exon:320exonMSAD_210141.t1:exon:320:740435..741545 +
MSAD_210141.t1:cdsCDSMSAD_210141.t1:cds:739065..739390 +
MSAD_210141.t1:cdsCDSMSAD_210141.t1:cds:740435..741278 +
MSAD_210140geneMSAD_210140:705085..706680 +
MSAD_210140.t1mRNAMSAD_210140.t1:705085..706680 +
MSAD_210140.t1:exon:321exonMSAD_210140.t1:exon:321:705085..705502 +
MSAD_210140.t1:exon:322exonMSAD_210140.t1:exon:322:705629..706680 +
MSAD_210140.t1:cdsCDSMSAD_210140.t1:cds:705180..705502 +
MSAD_210140.t1:cdsCDSMSAD_210140.t1:cds:705629..706460 +
MSAD_210143geneMSAD_210143:752489..760535 -
MSAD_210143.t1mRNAMSAD_210143.t1:752489..760535 -
MSAD_210143.t1:exon:337exonMSAD_210143.t1:exon:337:752489..753191 -
MSAD_210143.t1:exon:336exonMSAD_210143.t1:exon:336:754135..754186 -
MSAD_210143.t1:exon:335exonMSAD_210143.t1:exon:335:754792..754842 -
MSAD_210143.t1:exon:334exonMSAD_210143.t1:exon:334:755473..757374 -
MSAD_210143.t1:exon:333exonMSAD_210143.t1:exon:333:757479..757587 -
MSAD_210143.t1:exon:332exonMSAD_210143.t1:exon:332:757695..757797 -
MSAD_210143.t1:exon:331exonMSAD_210143.t1:exon:331:758097..758349 -
MSAD_210143.t1:exon:330exonMSAD_210143.t1:exon:330:758721..758866 -
MSAD_210143.t1:exon:329exonMSAD_210143.t1:exon:329:758920..759172 -
MSAD_210143.t1:exon:328exonMSAD_210143.t1:exon:328:759500..759587 -
MSAD_210143.t1:exon:327exonMSAD_210143.t1:exon:327:759689..759763 -
MSAD_210143.t1:exon:326exonMSAD_210143.t1:exon:326:759858..759933 -
MSAD_210143.t1:exon:325exonMSAD_210143.t1:exon:325:760045..760103 -
MSAD_210143.t1:exon:324exonMSAD_210143.t1:exon:324:760196..760262 -
MSAD_210143.t1:exon:323exonMSAD_210143.t1:exon:323:760356..760535 -
MSAD_210143.t1:cdsCDSMSAD_210143.t1:cds:760356..760508 -
MSAD_210143.t1:cdsCDSMSAD_210143.t1:cds:760196..760262 -
MSAD_210143.t1:cdsCDSMSAD_210143.t1:cds:760045..760103 -
MSAD_210143.t1:cdsCDSMSAD_210143.t1:cds:759858..759933 -
MSAD_210143.t1:cdsCDSMSAD_210143.t1:cds:759689..759763 -
MSAD_210143.t1:cdsCDSMSAD_210143.t1:cds:759500..759587 -
MSAD_210143.t1:cdsCDSMSAD_210143.t1:cds:758920..759172 -
MSAD_210143.t1:cdsCDSMSAD_210143.t1:cds:758721..758866 -
MSAD_210143.t1:cdsCDSMSAD_210143.t1:cds:758097..758349 -
MSAD_210143.t1:cdsCDSMSAD_210143.t1:cds:757695..757797 -
MSAD_210143.t1:cdsCDSMSAD_210143.t1:cds:757479..757587 -
MSAD_210143.t1:cdsCDSMSAD_210143.t1:cds:757137..757374 -
MSAD_210142geneMSAD_210142:743809..750924 -
MSAD_210142.t1mRNAMSAD_210142.t1:743809..750924 -
MSAD_210142.t1:exon:344exonMSAD_210142.t1:exon:344:743809..744478 -
MSAD_210142.t1:exon:343exonMSAD_210142.t1:exon:343:745106..745213 -
MSAD_210142.t1:exon:342exonMSAD_210142.t1:exon:342:745323..745691 -
MSAD_210142.t1:exon:341exonMSAD_210142.t1:exon:341:747223..747348 -
MSAD_210142.t1:exon:340exonMSAD_210142.t1:exon:340:748724..748834 -
MSAD_210142.t1:exon:339exonMSAD_210142.t1:exon:339:749003..749212 -
MSAD_210142.t1:exon:338exonMSAD_210142.t1:exon:338:749704..750924 -
MSAD_210142.t1:cdsCDSMSAD_210142.t1:cds:749704..750042 -
MSAD_210142.t1:cdsCDSMSAD_210142.t1:cds:749003..749212 -
MSAD_210142.t1:cdsCDSMSAD_210142.t1:cds:748724..748834 -
MSAD_210142.t1:cdsCDSMSAD_210142.t1:cds:747223..747348 -
MSAD_210142.t1:cdsCDSMSAD_210142.t1:cds:745323..745691 -
MSAD_210142.t1:cdsCDSMSAD_210142.t1:cds:745106..745213 -
MSAD_210142.t1:cdsCDSMSAD_210142.t1:cds:744140..744478 -
MSAD_210148geneMSAD_210148:813953..821347 +
MSAD_210148.t1mRNAMSAD_210148.t1:813953..821347 +
MSAD_210148.t1:exon:345exonMSAD_210148.t1:exon:345:813953..815294 +
MSAD_210148.t1:exon:346exonMSAD_210148.t1:exon:346:815714..815771 +
MSAD_210148.t1:exon:347exonMSAD_210148.t1:exon:347:815922..816160 +
MSAD_210148.t1:exon:348exonMSAD_210148.t1:exon:348:816239..816355 +
MSAD_210148.t1:exon:349exonMSAD_210148.t1:exon:349:817769..817843 +
MSAD_210148.t1:exon:350exonMSAD_210148.t1:exon:350:818204..818289 +
MSAD_210148.t1:exon:351exonMSAD_210148.t1:exon:351:818503..818552 +
MSAD_210148.t1:exon:352exonMSAD_210148.t1:exon:352:818762..818802 +
MSAD_210148.t1:exon:353exonMSAD_210148.t1:exon:353:819233..819403 +
MSAD_210148.t1:exon:354exonMSAD_210148.t1:exon:354:819502..819537 +
MSAD_210148.t1:exon:355exonMSAD_210148.t1:exon:355:819630..819697 +
MSAD_210148.t1:exon:356exonMSAD_210148.t1:exon:356:819942..820002 +
MSAD_210148.t1:exon:357exonMSAD_210148.t1:exon:357:820428..821347 +
MSAD_210148.t1:cdsCDSMSAD_210148.t1:cds:815169..815294 +
MSAD_210148.t1:cdsCDSMSAD_210148.t1:cds:815714..815771 +
MSAD_210148.t1:cdsCDSMSAD_210148.t1:cds:815922..816160 +
MSAD_210148.t1:cdsCDSMSAD_210148.t1:cds:816239..816355 +
MSAD_210148.t1:cdsCDSMSAD_210148.t1:cds:817769..817843 +
MSAD_210148.t1:cdsCDSMSAD_210148.t1:cds:818204..818289 +
MSAD_210148.t1:cdsCDSMSAD_210148.t1:cds:818503..818552 +
MSAD_210148.t1:cdsCDSMSAD_210148.t1:cds:818762..818802 +
MSAD_210148.t1:cdsCDSMSAD_210148.t1:cds:819233..819403 +
MSAD_210148.t1:cdsCDSMSAD_210148.t1:cds:819502..819537 +
MSAD_210148.t1:cdsCDSMSAD_210148.t1:cds:819630..819697 +
MSAD_210148.t1:cdsCDSMSAD_210148.t1:cds:819942..820002 +
MSAD_210148.t1:cdsCDSMSAD_210148.t1:cds:820428..820817 +
MSAD_210147geneMSAD_210147:805765..811055 +
MSAD_210147.t1mRNAMSAD_210147.t1:805765..811055 +
MSAD_210147.t1:exon:358exonMSAD_210147.t1:exon:358:805765..806174 +
MSAD_210147.t1:exon:359exonMSAD_210147.t1:exon:359:806270..806403 +
MSAD_210147.t1:exon:360exonMSAD_210147.t1:exon:360:806493..806622 +
MSAD_210147.t1:exon:361exonMSAD_210147.t1:exon:361:807255..807415 +
MSAD_210147.t1:exon:362exonMSAD_210147.t1:exon:362:807845..807946 +
MSAD_210147.t1:exon:363exonMSAD_210147.t1:exon:363:808052..808156 +
MSAD_210147.t1:exon:364exonMSAD_210147.t1:exon:364:808330..808458 +
MSAD_210147.t1:exon:365exonMSAD_210147.t1:exon:365:808612..808752 +
MSAD_210147.t1:exon:366exonMSAD_210147.t1:exon:366:809388..809488 +
MSAD_210147.t1:exon:367exonMSAD_210147.t1:exon:367:809819..809876 +
MSAD_210147.t1:exon:368exonMSAD_210147.t1:exon:368:810220..811055 +
MSAD_210147.t1:cdsCDSMSAD_210147.t1:cds:805943..806174 +
MSAD_210147.t1:cdsCDSMSAD_210147.t1:cds:806270..806403 +
MSAD_210147.t1:cdsCDSMSAD_210147.t1:cds:806493..806622 +
MSAD_210147.t1:cdsCDSMSAD_210147.t1:cds:807255..807415 +
MSAD_210147.t1:cdsCDSMSAD_210147.t1:cds:807845..807946 +
MSAD_210147.t1:cdsCDSMSAD_210147.t1:cds:808052..808156 +
MSAD_210147.t1:cdsCDSMSAD_210147.t1:cds:808330..808458 +
MSAD_210147.t1:cdsCDSMSAD_210147.t1:cds:808612..808752 +
MSAD_210147.t1:cdsCDSMSAD_210147.t1:cds:809388..809488 +
MSAD_210147.t1:cdsCDSMSAD_210147.t1:cds:809819..809876 +
MSAD_210147.t1:cdsCDSMSAD_210147.t1:cds:810220..810651 +
MSAD_210145geneMSAD_210145:792238..797176 +
MSAD_210145.t1mRNAMSAD_210145.t1:792238..797176 +
MSAD_210145.t1:exon:369exonMSAD_210145.t1:exon:369:792238..792581 +
MSAD_210145.t1:exon:370exonMSAD_210145.t1:exon:370:792676..792742 +
MSAD_210145.t1:exon:371exonMSAD_210145.t1:exon:371:792835..792893 +
MSAD_210145.t1:exon:372exonMSAD_210145.t1:exon:372:792984..793059 +
MSAD_210145.t1:exon:373exonMSAD_210145.t1:exon:373:793153..793227 +
MSAD_210145.t1:exon:374exonMSAD_210145.t1:exon:374:793979..794066 +
MSAD_210145.t1:exon:375exonMSAD_210145.t1:exon:375:794649..795310 +
MSAD_210145.t1:exon:376exonMSAD_210145.t1:exon:376:795637..795920 +
MSAD_210145.t1:exon:377exonMSAD_210145.t1:exon:377:796203..796305 +
MSAD_210145.t1:exon:378exonMSAD_210145.t1:exon:378:796517..796625 +
MSAD_210145.t1:exon:379exonMSAD_210145.t1:exon:379:796723..797176 +
MSAD_210145.t1:cdsCDSMSAD_210145.t1:cds:792429..792581 +
MSAD_210145.t1:cdsCDSMSAD_210145.t1:cds:792676..792742 +
MSAD_210145.t1:cdsCDSMSAD_210145.t1:cds:792835..792893 +
MSAD_210145.t1:cdsCDSMSAD_210145.t1:cds:792984..793059 +
MSAD_210145.t1:cdsCDSMSAD_210145.t1:cds:793153..793227 +
MSAD_210145.t1:cdsCDSMSAD_210145.t1:cds:793979..794066 +
MSAD_210145.t1:cdsCDSMSAD_210145.t1:cds:794649..794925 +
MSAD_210146geneMSAD_210146:798034..798255 +
MSAD_210146.t1mRNAMSAD_210146.t1:798034..798255 +
MSAD_210146.t1:exon:380exonMSAD_210146.t1:exon:380:798034..798255 +
MSAD_210146.t1:cdsCDSMSAD_210146.t1:cds:798034..798255 +
MSAD_210151geneMSAD_210151:851126..856574 -
MSAD_210151.t1mRNAMSAD_210151.t1:851126..856574 -
MSAD_210151.t1:exon:388exonMSAD_210151.t1:exon:388:851126..851543 -
MSAD_210151.t1:exon:387exonMSAD_210151.t1:exon:387:851636..851707 -
MSAD_210151.t1:exon:386exonMSAD_210151.t1:exon:386:851811..851889 -
MSAD_210151.t1:exon:385exonMSAD_210151.t1:exon:385:852205..852318 -
MSAD_210151.t1:exon:384exonMSAD_210151.t1:exon:384:852489..852530 -
MSAD_210151.t1:exon:383exonMSAD_210151.t1:exon:383:852808..852857 -
MSAD_210151.t1:exon:382exonMSAD_210151.t1:exon:382:853288..853333 -
MSAD_210151.t1:exon:381exonMSAD_210151.t1:exon:381:855990..856574 -
MSAD_210151.t1:cdsCDSMSAD_210151.t1:cds:855990..856561 -
MSAD_210151.t1:cdsCDSMSAD_210151.t1:cds:853288..853333 -
MSAD_210151.t1:cdsCDSMSAD_210151.t1:cds:852808..852857 -
MSAD_210151.t1:cdsCDSMSAD_210151.t1:cds:852489..852530 -
MSAD_210151.t1:cdsCDSMSAD_210151.t1:cds:852205..852318 -
MSAD_210151.t1:cdsCDSMSAD_210151.t1:cds:851811..851889 -
MSAD_210151.t1:cdsCDSMSAD_210151.t1:cds:851636..851707 -
MSAD_210151.t1:cdsCDSMSAD_210151.t1:cds:851496..851543 -
MSAD_210149geneMSAD_210149:822251..828802 -
MSAD_210149.t1mRNAMSAD_210149.t1:822251..828802 -
MSAD_210149.t1:exon:398exonMSAD_210149.t1:exon:398:822251..822856 -
MSAD_210149.t1:exon:397exonMSAD_210149.t1:exon:397:823433..823660 -
MSAD_210149.t1:exon:396exonMSAD_210149.t1:exon:396:823892..824152 -
MSAD_210149.t1:exon:395exonMSAD_210149.t1:exon:395:824388..824744 -
MSAD_210149.t1:exon:394exonMSAD_210149.t1:exon:394:825415..825528 -
MSAD_210149.t1:exon:393exonMSAD_210149.t1:exon:393:825638..825711 -
MSAD_210149.t1:exon:392exonMSAD_210149.t1:exon:392:826500..826683 -
MSAD_210149.t1:exon:391exonMSAD_210149.t1:exon:391:827000..827145 -
MSAD_210149.t1:exon:390exonMSAD_210149.t1:exon:390:827424..827776 -
MSAD_210149.t1:exon:389exonMSAD_210149.t1:exon:389:828557..828802 -
MSAD_210149.t1:cdsCDSMSAD_210149.t1:cds:828557..828714 -
MSAD_210149.t1:cdsCDSMSAD_210149.t1:cds:827424..827776 -
MSAD_210149.t1:cdsCDSMSAD_210149.t1:cds:827000..827145 -
MSAD_210149.t1:cdsCDSMSAD_210149.t1:cds:826500..826683 -
MSAD_210149.t1:cdsCDSMSAD_210149.t1:cds:825638..825711 -
MSAD_210149.t1:cdsCDSMSAD_210149.t1:cds:825415..825528 -
MSAD_210149.t1:cdsCDSMSAD_210149.t1:cds:824388..824744 -
MSAD_210149.t1:cdsCDSMSAD_210149.t1:cds:823892..824152 -
MSAD_210149.t1:cdsCDSMSAD_210149.t1:cds:823433..823660 -
MSAD_210149.t1:cdsCDSMSAD_210149.t1:cds:822665..822856 -
MSAD_210144geneMSAD_210144:777503..789872 -
MSAD_210144.t1mRNAMSAD_210144.t1:777503..789872 -
MSAD_210144.t1:exon:420exonMSAD_210144.t1:exon:420:777503..777996 -
MSAD_210144.t1:exon:419exonMSAD_210144.t1:exon:419:778318..778373 -
MSAD_210144.t1:exon:418exonMSAD_210144.t1:exon:418:778627..778701 -
MSAD_210144.t1:exon:417exonMSAD_210144.t1:exon:417:779275..779371 -
MSAD_210144.t1:exon:416exonMSAD_210144.t1:exon:416:779501..779625 -
MSAD_210144.t1:exon:415exonMSAD_210144.t1:exon:415:780263..780367 -
MSAD_210144.t1:exon:414exonMSAD_210144.t1:exon:414:781323..781460 -
MSAD_210144.t1:exon:413exonMSAD_210144.t1:exon:413:782745..782815 -
MSAD_210144.t1:exon:412exonMSAD_210144.t1:exon:412:782904..782971 -
MSAD_210144.t1:exon:411exonMSAD_210144.t1:exon:411:783049..783109 -
MSAD_210144.t1:exon:410exonMSAD_210144.t1:exon:410:783800..783890 -
MSAD_210144.t1:exon:409exonMSAD_210144.t1:exon:409:784092..784170 -
MSAD_210144.t1:exon:408exonMSAD_210144.t1:exon:408:784297..784357 -
MSAD_210144.t1:exon:407exonMSAD_210144.t1:exon:407:784535..784612 -
MSAD_210144.t1:exon:406exonMSAD_210144.t1:exon:406:784716..784785 -
MSAD_210144.t1:exon:405exonMSAD_210144.t1:exon:405:784905..784979 -
MSAD_210144.t1:exon:404exonMSAD_210144.t1:exon:404:786114..786189 -
MSAD_210144.t1:exon:403exonMSAD_210144.t1:exon:403:786314..786400 -
MSAD_210144.t1:exon:402exonMSAD_210144.t1:exon:402:786495..786631 -
MSAD_210144.t1:exon:401exonMSAD_210144.t1:exon:401:788080..788146 -
MSAD_210144.t1:exon:400exonMSAD_210144.t1:exon:400:788230..788511 -
MSAD_210144.t1:exon:399exonMSAD_210144.t1:exon:399:789830..789872 -
MSAD_210144.t1:cdsCDSMSAD_210144.t1:cds:788230..788294 -
MSAD_210144.t1:cdsCDSMSAD_210144.t1:cds:788080..788146 -
MSAD_210144.t1:cdsCDSMSAD_210144.t1:cds:786495..786631 -
MSAD_210144.t1:cdsCDSMSAD_210144.t1:cds:786314..786400 -
MSAD_210144.t1:cdsCDSMSAD_210144.t1:cds:786114..786189 -
MSAD_210144.t1:cdsCDSMSAD_210144.t1:cds:784905..784979 -
MSAD_210144.t1:cdsCDSMSAD_210144.t1:cds:784716..784785 -
MSAD_210144.t1:cdsCDSMSAD_210144.t1:cds:784535..784612 -
MSAD_210144.t1:cdsCDSMSAD_210144.t1:cds:784297..784357 -
MSAD_210144.t1:cdsCDSMSAD_210144.t1:cds:784092..784170 -
MSAD_210144.t1:cdsCDSMSAD_210144.t1:cds:783800..783890 -
MSAD_210144.t1:cdsCDSMSAD_210144.t1:cds:783049..783109 -
MSAD_210144.t1:cdsCDSMSAD_210144.t1:cds:782904..782971 -
MSAD_210144.t1:cdsCDSMSAD_210144.t1:cds:782745..782815 -
MSAD_210144.t1:cdsCDSMSAD_210144.t1:cds:781323..781460 -
MSAD_210144.t1:cdsCDSMSAD_210144.t1:cds:780263..780367 -
MSAD_210144.t1:cdsCDSMSAD_210144.t1:cds:779501..779625 -
MSAD_210144.t1:cdsCDSMSAD_210144.t1:cds:779275..779371 -
MSAD_210144.t1:cdsCDSMSAD_210144.t1:cds:778627..778701 -
MSAD_210144.t1:cdsCDSMSAD_210144.t1:cds:778318..778373 -
MSAD_210144.t1:cdsCDSMSAD_210144.t1:cds:777921..777996 -
MSAD_210150geneMSAD_210150:836328..841359 -
MSAD_210150.t1mRNAMSAD_210150.t1:836328..841359 -
MSAD_210150.t1:exon:430exonMSAD_210150.t1:exon:430:836328..836663 -
MSAD_210150.t1:exon:429exonMSAD_210150.t1:exon:429:837134..837329 -
MSAD_210150.t1:exon:428exonMSAD_210150.t1:exon:428:837551..837592 -
MSAD_210150.t1:exon:427exonMSAD_210150.t1:exon:427:838137..838289 -
MSAD_210150.t1:exon:426exonMSAD_210150.t1:exon:426:838760..838793 -
MSAD_210150.t1:exon:425exonMSAD_210150.t1:exon:425:838944..839051 -
MSAD_210150.t1:exon:424exonMSAD_210150.t1:exon:424:839150..839239 -
MSAD_210150.t1:exon:423exonMSAD_210150.t1:exon:423:839539..839619 -
MSAD_210150.t1:exon:422exonMSAD_210150.t1:exon:422:839745..839822 -
MSAD_210150.t1:exon:421exonMSAD_210150.t1:exon:421:841174..841359 -
MSAD_210150.t1:cdsCDSMSAD_210150.t1:cds:841174..841261 -
MSAD_210150.t1:cdsCDSMSAD_210150.t1:cds:839745..839822 -
MSAD_210150.t1:cdsCDSMSAD_210150.t1:cds:839539..839619 -
MSAD_210150.t1:cdsCDSMSAD_210150.t1:cds:839211..839239 -
MSAD_210154geneMSAD_210154:867203..868667 -
MSAD_210154.t1mRNAMSAD_210154.t1:867203..868667 -
MSAD_210154.t1:exon:432exonMSAD_210154.t1:exon:432:867203..867885 -
MSAD_210154.t1:exon:431exonMSAD_210154.t1:exon:431:868503..868667 -
MSAD_210154.t1:cdsCDSMSAD_210154.t1:cds:868503..868560 -
MSAD_210154.t1:cdsCDSMSAD_210154.t1:cds:867722..867885 -
MSAD_210155geneMSAD_210155:872979..874375 -
MSAD_210155.t1mRNAMSAD_210155.t1:872979..874375 -
MSAD_210155.t1:exon:434exonMSAD_210155.t1:exon:434:872979..873501 -
MSAD_210155.t1:exon:433exonMSAD_210155.t1:exon:433:874125..874375 -
MSAD_210155.t1:cdsCDSMSAD_210155.t1:cds:874125..874182 -
MSAD_210155.t1:cdsCDSMSAD_210155.t1:cds:873335..873501 -
MSAD_210156geneMSAD_210156:880124..881688 -
MSAD_210156.t1mRNAMSAD_210156.t1:880124..881688 -
MSAD_210156.t1:exon:436exonMSAD_210156.t1:exon:436:880124..880552 -
MSAD_210156.t1:exon:435exonMSAD_210156.t1:exon:435:881496..881688 -
MSAD_210156.t1:cdsCDSMSAD_210156.t1:cds:881496..881553 -
MSAD_210156.t1:cdsCDSMSAD_210156.t1:cds:880389..880552 -
MSAD_210153geneMSAD_210153:863884..864627 -
MSAD_210153.t1mRNAMSAD_210153.t1:863884..864627 -
MSAD_210153.t1:exon:438exonMSAD_210153.t1:exon:438:864570..864627 -
MSAD_210153.t1:exon:437exonMSAD_210153.t1:exon:437:863884..864044 -
MSAD_210153.t1:cdsCDSMSAD_210153.t1:cds:864570..864627 -
MSAD_210153.t1:cdsCDSMSAD_210153.t1:cds:863884..864044 -
MSAD_210161geneMSAD_210161:924590..927324 +
MSAD_210161.t1mRNAMSAD_210161.t1:924590..927324 +
MSAD_210161.t1:exon:439exonMSAD_210161.t1:exon:439:924590..924599 +
MSAD_210161.t1:exon:440exonMSAD_210161.t1:exon:440:925749..925826 +
MSAD_210161.t1:exon:441exonMSAD_210161.t1:exon:441:926075..926217 +
MSAD_210161.t1:exon:442exonMSAD_210161.t1:exon:442:926458..926584 +
MSAD_210161.t1:exon:443exonMSAD_210161.t1:exon:443:927134..927324 +
MSAD_210161.t1:cdsCDSMSAD_210161.t1:cds:924590..924599 +
MSAD_210161.t1:cdsCDSMSAD_210161.t1:cds:925749..925826 +
MSAD_210161.t1:cdsCDSMSAD_210161.t1:cds:926075..926217 +
MSAD_210161.t1:cdsCDSMSAD_210161.t1:cds:926458..926584 +
MSAD_210161.t1:cdsCDSMSAD_210161.t1:cds:927134..927324 +
MSAD_210158geneMSAD_210158:897977..901870 +
MSAD_210158.t1mRNAMSAD_210158.t1:897977..901870 +
MSAD_210158.t1:exon:444exonMSAD_210158.t1:exon:444:897977..898337 +
MSAD_210158.t1:exon:445exonMSAD_210158.t1:exon:445:898743..898849 +
MSAD_210158.t1:exon:446exonMSAD_210158.t1:exon:446:899141..899485 +
MSAD_210158.t1:exon:447exonMSAD_210158.t1:exon:447:901793..901870 +
MSAD_210158.t1:cdsCDSMSAD_210158.t1:cds:897977..898337 +
MSAD_210158.t1:cdsCDSMSAD_210158.t1:cds:898743..898849 +
MSAD_210158.t1:cdsCDSMSAD_210158.t1:cds:899141..899485 +
MSAD_210158.t1:cdsCDSMSAD_210158.t1:cds:901793..901870 +
MSAD_210169geneMSAD_210169:962135..962807 +
MSAD_210169.t1mRNAMSAD_210169.t1:962135..962807 +
MSAD_210169.t1:exon:448exonMSAD_210169.t1:exon:448:962135..962237 +
MSAD_210169.t1:exon:449exonMSAD_210169.t1:exon:449:962435..962558 +
MSAD_210169.t1:exon:450exonMSAD_210169.t1:exon:450:962623..962695 +
MSAD_210169.t1:exon:451exonMSAD_210169.t1:exon:451:962718..962807 +
MSAD_210169.t1:cdsCDSMSAD_210169.t1:cds:962135..962237 +
MSAD_210169.t1:cdsCDSMSAD_210169.t1:cds:962435..962558 +
MSAD_210169.t1:cdsCDSMSAD_210169.t1:cds:962623..962695 +
MSAD_210169.t1:cdsCDSMSAD_210169.t1:cds:962718..962807 +
MSAD_210157geneMSAD_210157:892012..893466 -
MSAD_210157.t1mRNAMSAD_210157.t1:892012..893466 -
MSAD_210157.t1:exon:453exonMSAD_210157.t1:exon:453:892012..892575 -
MSAD_210157.t1:exon:452exonMSAD_210157.t1:exon:452:892957..893466 -
MSAD_210157.t1:cdsCDSMSAD_210157.t1:cds:892957..893366 -
MSAD_210157.t1:cdsCDSMSAD_210157.t1:cds:892392..892575 -
MSAD_210160geneMSAD_210160:919615..920757 -
MSAD_210160.t1mRNAMSAD_210160.t1:919615..920757 -
MSAD_210160.t1:exon:454exonMSAD_210160.t1:exon:454:919615..920757 -
MSAD_210160.t1:cdsCDSMSAD_210160.t1:cds:919615..920757 -
MSAD_210171geneMSAD_210171:967600..972063 -
MSAD_210171.t1mRNAMSAD_210171.t1:967600..972063 -
MSAD_210171.t1:exon:456exonMSAD_210171.t1:exon:456:967600..968150 -
MSAD_210171.t1:exon:455exonMSAD_210171.t1:exon:455:971669..972063 -
MSAD_210171.t1:cdsCDSMSAD_210171.t1:cds:971669..971873 -
MSAD_210171.t1:cdsCDSMSAD_210171.t1:cds:967837..968150 -
MSAD_210159geneMSAD_210159:903963..911992 -
MSAD_210159.t1mRNAMSAD_210159.t1:903963..911992 -
MSAD_210159.t1:exon:462exonMSAD_210159.t1:exon:462:911857..911992 -
MSAD_210159.t1:exon:461exonMSAD_210159.t1:exon:461:908394..908408 -
MSAD_210159.t1:exon:460exonMSAD_210159.t1:exon:460:904928..905093 -
MSAD_210159.t1:exon:459exonMSAD_210159.t1:exon:459:904481..904883 -
MSAD_210159.t1:exon:458exonMSAD_210159.t1:exon:458:904218..904448 -
MSAD_210159.t1:exon:457exonMSAD_210159.t1:exon:457:903963..904136 -
MSAD_210159.t1:cdsCDSMSAD_210159.t1:cds:911857..911992 -
MSAD_210159.t1:cdsCDSMSAD_210159.t1:cds:908394..908408 -
MSAD_210159.t1:cdsCDSMSAD_210159.t1:cds:904928..905093 -
MSAD_210159.t1:cdsCDSMSAD_210159.t1:cds:904481..904883 -
MSAD_210159.t1:cdsCDSMSAD_210159.t1:cds:904218..904448 -
MSAD_210159.t1:cdsCDSMSAD_210159.t1:cds:903963..904136 -
MSAD_210162geneMSAD_210162:932603..932980 -
MSAD_210162.t1mRNAMSAD_210162.t1:932603..932980 -
MSAD_210162.t1:exon:463exonMSAD_210162.t1:exon:463:932603..932980 -
MSAD_210162.t1:cdsCDSMSAD_210162.t1:cds:932603..932980 -
MSAD_210168geneMSAD_210168:956732..964728 -
MSAD_210168.t1mRNAMSAD_210168.t1:956732..964728 -
MSAD_210168.t1:exon:466exonMSAD_210168.t1:exon:466:956732..957220 -
MSAD_210168.t1:exon:465exonMSAD_210168.t1:exon:465:958000..958048 -
MSAD_210168.t1:exon:464exonMSAD_210168.t1:exon:464:964705..964728 -
MSAD_210168.t1:cdsCDSMSAD_210168.t1:cds:964705..964728 -
MSAD_210168.t1:cdsCDSMSAD_210168.t1:cds:958000..958048 -
MSAD_210168.t1:cdsCDSMSAD_210168.t1:cds:957054..957220 -
MSAD_210164geneMSAD_210164:935500..936211 -
MSAD_210164.t1mRNAMSAD_210164.t1:935500..936211 -
MSAD_210164.t1:exon:468exonMSAD_210164.t1:exon:468:936053..936211 -
MSAD_210164.t1:exon:467exonMSAD_210164.t1:exon:467:935500..935724 -
MSAD_210164.t1:cdsCDSMSAD_210164.t1:cds:936053..936211 -
MSAD_210164.t1:cdsCDSMSAD_210164.t1:cds:935500..935724 -
MSAD_210165geneMSAD_210165:936478..936897 -
MSAD_210165.t1mRNAMSAD_210165.t1:936478..936897 -
MSAD_210165.t1:exon:471exonMSAD_210165.t1:exon:471:936817..936897 -
MSAD_210165.t1:exon:470exonMSAD_210165.t1:exon:470:936606..936706 -
MSAD_210165.t1:exon:469exonMSAD_210165.t1:exon:469:936478..936592 -
MSAD_210165.t1:cdsCDSMSAD_210165.t1:cds:936817..936897 -
MSAD_210165.t1:cdsCDSMSAD_210165.t1:cds:936606..936706 -
MSAD_210165.t1:cdsCDSMSAD_210165.t1:cds:936478..936592 -
MSAD_210163geneMSAD_210163:933007..935142 -
MSAD_210163.t1mRNAMSAD_210163.t1:933007..935142 -
MSAD_210163.t1:exon:475exonMSAD_210163.t1:exon:475:935092..935142 -
MSAD_210163.t1:exon:474exonMSAD_210163.t1:exon:474:934793..934859 -
MSAD_210163.t1:exon:473exonMSAD_210163.t1:exon:473:933541..933642 -
MSAD_210163.t1:exon:472exonMSAD_210163.t1:exon:472:933007..933047 -
MSAD_210163.t1:cdsCDSMSAD_210163.t1:cds:935092..935142 -
MSAD_210163.t1:cdsCDSMSAD_210163.t1:cds:934793..934859 -
MSAD_210163.t1:cdsCDSMSAD_210163.t1:cds:933541..933642 -
MSAD_210163.t1:cdsCDSMSAD_210163.t1:cds:933007..933047 -
MSAD_210166geneMSAD_210166:941416..943680 -
MSAD_210166.t1mRNAMSAD_210166.t1:941416..943680 -
MSAD_210166.t1:exon:478exonMSAD_210166.t1:exon:478:943336..943680 -
MSAD_210166.t1:exon:477exonMSAD_210166.t1:exon:477:942600..943244 -
MSAD_210166.t1:exon:476exonMSAD_210166.t1:exon:476:941416..942531 -
MSAD_210166.t1:cdsCDSMSAD_210166.t1:cds:943336..943680 -
MSAD_210166.t1:cdsCDSMSAD_210166.t1:cds:942600..943244 -
MSAD_210166.t1:cdsCDSMSAD_210166.t1:cds:941416..942531 -
MSAD_210167geneMSAD_210167:951427..956051 +
MSAD_210167.t1mRNAMSAD_210167.t1:951427..956051 +
MSAD_210167.t1:exon:479exonMSAD_210167.t1:exon:479:951427..951551 +
MSAD_210167.t1:exon:480exonMSAD_210167.t1:exon:480:951738..951815 +
MSAD_210167.t1:exon:481exonMSAD_210167.t1:exon:481:951839..951991 +
MSAD_210167.t1:exon:482exonMSAD_210167.t1:exon:482:952000..952164 +
MSAD_210167.t1:exon:483exonMSAD_210167.t1:exon:483:954345..954468 +
MSAD_210167.t1:exon:484exonMSAD_210167.t1:exon:484:954492..954633 +
MSAD_210167.t1:exon:485exonMSAD_210167.t1:exon:485:955894..955957 +
MSAD_210167.t1:exon:486exonMSAD_210167.t1:exon:486:955976..956051 +
MSAD_210167.t1:cdsCDSMSAD_210167.t1:cds:951427..951551 +
MSAD_210167.t1:cdsCDSMSAD_210167.t1:cds:951738..951815 +
MSAD_210167.t1:cdsCDSMSAD_210167.t1:cds:951839..951991 +
MSAD_210167.t1:cdsCDSMSAD_210167.t1:cds:952000..952164 +
MSAD_210167.t1:cdsCDSMSAD_210167.t1:cds:954345..954468 +
MSAD_210167.t1:cdsCDSMSAD_210167.t1:cds:954492..954633 +
MSAD_210167.t1:cdsCDSMSAD_210167.t1:cds:955894..955957 +
MSAD_210167.t1:cdsCDSMSAD_210167.t1:cds:955976..956051 +
MSAD_210170geneMSAD_210170:964742..966547 -
MSAD_210170.t1mRNAMSAD_210170.t1:964742..966547 -
MSAD_210170.t1:exon:489exonMSAD_210170.t1:exon:489:966490..966547 -
MSAD_210170.t1:exon:488exonMSAD_210170.t1:exon:488:966099..966216 -
MSAD_210170.t1:exon:487exonMSAD_210170.t1:exon:487:964742..964826 -
MSAD_210170.t1:cdsCDSMSAD_210170.t1:cds:966490..966547 -
MSAD_210170.t1:cdsCDSMSAD_210170.t1:cds:966099..966216 -
MSAD_210170.t1:cdsCDSMSAD_210170.t1:cds:964742..964826 -
MSAD_210177geneMSAD_210177:1018368..1019398 +
MSAD_210177.t1mRNAMSAD_210177.t1:1018368..1019398 +
MSAD_210177.t1:exon:490exonMSAD_210177.t1:exon:490:1018368..1018673 +
MSAD_210177.t1:exon:491exonMSAD_210177.t1:exon:491:1019393..1019398 +
MSAD_210177.t1:cdsCDSMSAD_210177.t1:cds:1018368..1018673 +
MSAD_210177.t1:cdsCDSMSAD_210177.t1:cds:1019393..1019398 +
MSAD_210176geneMSAD_210176:1014984..1015828 +
MSAD_210176.t1mRNAMSAD_210176.t1:1014984..1015828 +
MSAD_210176.t1:exon:492exonMSAD_210176.t1:exon:492:1014984..1015161 +
MSAD_210176.t1:exon:493exonMSAD_210176.t1:exon:493:1015362..1015828 +
MSAD_210176.t1:cdsCDSMSAD_210176.t1:cds:1015134..1015161 +
MSAD_210176.t1:cdsCDSMSAD_210176.t1:cds:1015362..1015828 +
MSAD_210181geneMSAD_210181:1057998..1088748 +
MSAD_210181.t1mRNAMSAD_210181.t1:1057998..1088748 +
MSAD_210181.t1:exon:494exonMSAD_210181.t1:exon:494:1057998..1058224 +
MSAD_210181.t1:exon:495exonMSAD_210181.t1:exon:495:1059650..1059958 +
MSAD_210181.t1:exon:496exonMSAD_210181.t1:exon:496:1060062..1060125 +
MSAD_210181.t1:exon:497exonMSAD_210181.t1:exon:497:1060474..1060613 +
MSAD_210181.t1:exon:498exonMSAD_210181.t1:exon:498:1060709..1061020 +
MSAD_210181.t1:exon:499exonMSAD_210181.t1:exon:499:1061646..1061891 +
MSAD_210181.t1:exon:500exonMSAD_210181.t1:exon:500:1067549..1067692 +
MSAD_210181.t1:exon:501exonMSAD_210181.t1:exon:501:1078958..1079012 +
MSAD_210181.t1:exon:502exonMSAD_210181.t1:exon:502:1080902..1081041 +
MSAD_210181.t1:exon:503exonMSAD_210181.t1:exon:503:1081881..1082195 +
MSAD_210181.t1:exon:504exonMSAD_210181.t1:exon:504:1086216..1086974 +
MSAD_210181.t1:exon:505exonMSAD_210181.t1:exon:505:1087074..1087137 +
MSAD_210181.t1:exon:506exonMSAD_210181.t1:exon:506:1087529..1087668 +
MSAD_210181.t1:exon:507exonMSAD_210181.t1:exon:507:1088338..1088748 +
MSAD_210181.t1:cdsCDSMSAD_210181.t1:cds:1058150..1058224 +
MSAD_210181.t1:cdsCDSMSAD_210181.t1:cds:1059650..1059958 +
MSAD_210181.t1:cdsCDSMSAD_210181.t1:cds:1060062..1060125 +
MSAD_210181.t1:cdsCDSMSAD_210181.t1:cds:1060474..1060613 +
MSAD_210181.t1:cdsCDSMSAD_210181.t1:cds:1060709..1061020 +
MSAD_210181.t1:cdsCDSMSAD_210181.t1:cds:1061646..1061891 +
MSAD_210181.t1:cdsCDSMSAD_210181.t1:cds:1067549..1067692 +
MSAD_210181.t1:cdsCDSMSAD_210181.t1:cds:1078958..1079012 +
MSAD_210181.t1:cdsCDSMSAD_210181.t1:cds:1080902..1081041 +
MSAD_210181.t1:cdsCDSMSAD_210181.t1:cds:1081881..1082195 +
MSAD_210181.t1:cdsCDSMSAD_210181.t1:cds:1086216..1086974 +
MSAD_210181.t1:cdsCDSMSAD_210181.t1:cds:1087074..1087137 +
MSAD_210181.t1:cdsCDSMSAD_210181.t1:cds:1087529..1087668 +
MSAD_210181.t1:cdsCDSMSAD_210181.t1:cds:1088338..1088748 +
MSAD_210175geneMSAD_210175:1011769..1012198 +
MSAD_210175.t1mRNAMSAD_210175.t1:1011769..1012198 +
MSAD_210175.t1:exon:508exonMSAD_210175.t1:exon:508:1011769..1011834 +
MSAD_210175.t1:exon:509exonMSAD_210175.t1:exon:509:1012064..1012198 +
MSAD_210175.t1:cdsCDSMSAD_210175.t1:cds:1011769..1011834 +
MSAD_210175.t1:cdsCDSMSAD_210175.t1:cds:1012064..1012198 +
MSAD_210178geneMSAD_210178:1029955..1036327 +
MSAD_210178.t1mRNAMSAD_210178.t1:1029955..1036327 +
MSAD_210178.t1:exon:510exonMSAD_210178.t1:exon:510:1029955..1030285 +
MSAD_210178.t1:exon:511exonMSAD_210178.t1:exon:511:1032690..1032747 +
MSAD_210178.t1:exon:512exonMSAD_210178.t1:exon:512:1033468..1033824 +
MSAD_210178.t1:exon:513exonMSAD_210178.t1:exon:513:1034688..1034799 +
MSAD_210178.t1:exon:514exonMSAD_210178.t1:exon:514:1034914..1034973 +
MSAD_210178.t1:exon:515exonMSAD_210178.t1:exon:515:1035321..1035425 +
MSAD_210178.t1:exon:516exonMSAD_210178.t1:exon:516:1035687..1036327 +
MSAD_210178.t1:cdsCDSMSAD_210178.t1:cds:1032710..1032747 +
MSAD_210178.t1:cdsCDSMSAD_210178.t1:cds:1033468..1033824 +
MSAD_210178.t1:cdsCDSMSAD_210178.t1:cds:1034688..1034799 +
MSAD_210178.t1:cdsCDSMSAD_210178.t1:cds:1034914..1034973 +
MSAD_210178.t1:cdsCDSMSAD_210178.t1:cds:1035321..1035425 +
MSAD_210178.t1:cdsCDSMSAD_210178.t1:cds:1035687..1035803 +
MSAD_210180geneMSAD_210180:1043496..1045530 +
MSAD_210180.t1mRNAMSAD_210180.t1:1043496..1045530 +
MSAD_210180.t1:exon:517exonMSAD_210180.t1:exon:517:1043496..1043510 +
MSAD_210180.t1:exon:518exonMSAD_210180.t1:exon:518:1043801..1044115 +
MSAD_210180.t1:exon:519exonMSAD_210180.t1:exon:519:1044210..1044273 +
MSAD_210180.t1:exon:520exonMSAD_210180.t1:exon:520:1044628..1044767 +
MSAD_210180.t1:exon:521exonMSAD_210180.t1:exon:521:1044865..1045176 +
MSAD_210180.t1:exon:522exonMSAD_210180.t1:exon:522:1045288..1045530 +
MSAD_210180.t1:cdsCDSMSAD_210180.t1:cds:1043496..1043510 +
MSAD_210180.t1:cdsCDSMSAD_210180.t1:cds:1043801..1044115 +
MSAD_210180.t1:cdsCDSMSAD_210180.t1:cds:1044210..1044273 +
MSAD_210180.t1:cdsCDSMSAD_210180.t1:cds:1044628..1044767 +
MSAD_210180.t1:cdsCDSMSAD_210180.t1:cds:1044865..1045176 +
MSAD_210180.t1:cdsCDSMSAD_210180.t1:cds:1045288..1045530 +
MSAD_210179geneMSAD_210179:1037901..1041068 +
MSAD_210179.t1mRNAMSAD_210179.t1:1037901..1041068 +
MSAD_210179.t1:exon:523exonMSAD_210179.t1:exon:523:1037901..1037951 +
MSAD_210179.t1:exon:524exonMSAD_210179.t1:exon:524:1039091..1039426 +
MSAD_210179.t1:exon:525exonMSAD_210179.t1:exon:525:1039517..1039580 +
MSAD_210179.t1:exon:526exonMSAD_210179.t1:exon:526:1039980..1040119 +
MSAD_210179.t1:exon:527exonMSAD_210179.t1:exon:527:1040215..1040526 +
MSAD_210179.t1:exon:528exonMSAD_210179.t1:exon:528:1040817..1041068 +
MSAD_210179.t1:cdsCDSMSAD_210179.t1:cds:1037901..1037951 +
MSAD_210179.t1:cdsCDSMSAD_210179.t1:cds:1039091..1039426 +
MSAD_210179.t1:cdsCDSMSAD_210179.t1:cds:1039517..1039580 +
MSAD_210179.t1:cdsCDSMSAD_210179.t1:cds:1039980..1040119 +
MSAD_210179.t1:cdsCDSMSAD_210179.t1:cds:1040215..1040526 +
MSAD_210179.t1:cdsCDSMSAD_210179.t1:cds:1040817..1041068 +
MSAD_210174geneMSAD_210174:1005103..1008484 -
MSAD_210174.t1mRNAMSAD_210174.t1:1005103..1008484 -
MSAD_210174.t1:exon:532exonMSAD_210174.t1:exon:532:1005103..1005568 -
MSAD_210174.t1:exon:531exonMSAD_210174.t1:exon:531:1007236..1007349 -
MSAD_210174.t1:exon:530exonMSAD_210174.t1:exon:530:1007454..1007582 -
MSAD_210174.t1:exon:529exonMSAD_210174.t1:exon:529:1008294..1008484 -
MSAD_210174.t1:cdsCDSMSAD_210174.t1:cds:1007454..1007568 -
MSAD_210174.t1:cdsCDSMSAD_210174.t1:cds:1007236..1007349 -
MSAD_210174.t1:cdsCDSMSAD_210174.t1:cds:1005426..1005568 -
MSAD_210172geneMSAD_210172:983740..999189 -
MSAD_210172.t1mRNAMSAD_210172.t1:983740..999189 -
MSAD_210172.t1:exon:538exonMSAD_210172.t1:exon:538:983740..984032 -
MSAD_210172.t1:exon:537exonMSAD_210172.t1:exon:537:984139..984195 -
MSAD_210172.t1:exon:536exonMSAD_210172.t1:exon:536:994995..995345 -
MSAD_210172.t1:exon:535exonMSAD_210172.t1:exon:535:995505..995561 -
MSAD_210172.t1:exon:534exonMSAD_210172.t1:exon:534:998576..998785 -
MSAD_210172.t1:exon:533exonMSAD_210172.t1:exon:533:998951..999189 -
MSAD_210172.t1:cdsCDSMSAD_210172.t1:cds:998951..999047 -
MSAD_210172.t1:cdsCDSMSAD_210172.t1:cds:998576..998785 -
MSAD_210172.t1:cdsCDSMSAD_210172.t1:cds:995505..995561 -
MSAD_210172.t1:cdsCDSMSAD_210172.t1:cds:994995..995345 -
MSAD_210172.t1:cdsCDSMSAD_210172.t1:cds:984139..984195 -
MSAD_210172.t1:cdsCDSMSAD_210172.t1:cds:983740..984032 -
MSAD_210173geneMSAD_210173:1002934..1003526 +
MSAD_210173.t1mRNAMSAD_210173.t1:1002934..1003526 +
MSAD_210173.t1:exon:539exonMSAD_210173.t1:exon:539:1002934..1003072 +
MSAD_210173.t1:exon:540exonMSAD_210173.t1:exon:540:1003096..1003526 +
MSAD_210173.t1:cdsCDSMSAD_210173.t1:cds:1002934..1003072 +
MSAD_210173.t1:cdsCDSMSAD_210173.t1:cds:1003096..1003526 +
MSAD_210188geneMSAD_210188:1158174..1167575 +
MSAD_210188.t1mRNAMSAD_210188.t1:1158174..1167575 +
MSAD_210188.t1:exon:541exonMSAD_210188.t1:exon:541:1158174..1158635 +
MSAD_210188.t1:exon:542exonMSAD_210188.t1:exon:542:1158727..1158839 +
MSAD_210188.t1:exon:543exonMSAD_210188.t1:exon:543:1159119..1159175 +
MSAD_210188.t1:exon:544exonMSAD_210188.t1:exon:544:1159474..1159569 +
MSAD_210188.t1:exon:545exonMSAD_210188.t1:exon:545:1159664..1159734 +
MSAD_210188.t1:exon:546exonMSAD_210188.t1:exon:546:1160039..1160084 +
MSAD_210188.t1:exon:547exonMSAD_210188.t1:exon:547:1161508..1161588 +
MSAD_210188.t1:exon:548exonMSAD_210188.t1:exon:548:1161675..1161734 +
MSAD_210188.t1:exon:549exonMSAD_210188.t1:exon:549:1161880..1161930 +
MSAD_210188.t1:exon:550exonMSAD_210188.t1:exon:550:1162165..1162262 +
MSAD_210188.t1:exon:551exonMSAD_210188.t1:exon:551:1162349..1162397 +
MSAD_210188.t1:exon:552exonMSAD_210188.t1:exon:552:1166339..1166383 +
MSAD_210188.t1:exon:553exonMSAD_210188.t1:exon:553:1166802..1167575 +
MSAD_210188.t1:cdsCDSMSAD_210188.t1:cds:1158617..1158635 +
MSAD_210188.t1:cdsCDSMSAD_210188.t1:cds:1158727..1158839 +
MSAD_210188.t1:cdsCDSMSAD_210188.t1:cds:1159119..1159175 +
MSAD_210188.t1:cdsCDSMSAD_210188.t1:cds:1159474..1159569 +
MSAD_210188.t1:cdsCDSMSAD_210188.t1:cds:1159664..1159734 +
MSAD_210188.t1:cdsCDSMSAD_210188.t1:cds:1160039..1160084 +
MSAD_210188.t1:cdsCDSMSAD_210188.t1:cds:1161508..1161588 +
MSAD_210188.t1:cdsCDSMSAD_210188.t1:cds:1161675..1161734 +
MSAD_210188.t1:cdsCDSMSAD_210188.t1:cds:1161880..1161930 +
MSAD_210188.t1:cdsCDSMSAD_210188.t1:cds:1162165..1162262 +
MSAD_210188.t1:cdsCDSMSAD_210188.t1:cds:1162349..1162397 +
MSAD_210188.t1:cdsCDSMSAD_210188.t1:cds:1166339..1166383 +
MSAD_210188.t1:cdsCDSMSAD_210188.t1:cds:1166802..1167224 +
MSAD_210185geneMSAD_210185:1138284..1141040 +
MSAD_210185.t1mRNAMSAD_210185.t1:1138284..1141040 +
MSAD_210185.t1:exon:554exonMSAD_210185.t1:exon:554:1138284..1141040 +
MSAD_210185.t1:cdsCDSMSAD_210185.t1:cds:1138284..1141040 +
MSAD_210186geneMSAD_210186:1143213..1145966 +
MSAD_210186.t1mRNAMSAD_210186.t1:1143213..1145966 +
MSAD_210186.t1:exon:555exonMSAD_210186.t1:exon:555:1143213..1145966 +
MSAD_210186.t1:cdsCDSMSAD_210186.t1:cds:1143213..1145966 +
MSAD_210184geneMSAD_210184:1124610..1134730 +
MSAD_210184.t1mRNAMSAD_210184.t1:1124610..1134730 +
MSAD_210184.t1:exon:556exonMSAD_210184.t1:exon:556:1124610..1124886 +
MSAD_210184.t1:exon:557exonMSAD_210184.t1:exon:557:1126154..1126825 +
MSAD_210184.t1:exon:558exonMSAD_210184.t1:exon:558:1126924..1126987 +
MSAD_210184.t1:exon:559exonMSAD_210184.t1:exon:559:1127315..1127454 +
MSAD_210184.t1:exon:560exonMSAD_210184.t1:exon:560:1128097..1128319 +
MSAD_210184.t1:exon:561exonMSAD_210184.t1:exon:561:1130605..1130726 +
MSAD_210184.t1:exon:562exonMSAD_210184.t1:exon:562:1132166..1132471 +
MSAD_210184.t1:exon:563exonMSAD_210184.t1:exon:563:1132573..1132636 +
MSAD_210184.t1:exon:564exonMSAD_210184.t1:exon:564:1132936..1133075 +
MSAD_210184.t1:exon:565exonMSAD_210184.t1:exon:565:1133171..1133479 +
MSAD_210184.t1:exon:566exonMSAD_210184.t1:exon:566:1133731..1134730 +
MSAD_210184.t1:cdsCDSMSAD_210184.t1:cds:1124812..1124886 +
MSAD_210184.t1:cdsCDSMSAD_210184.t1:cds:1126154..1126825 +
MSAD_210184.t1:cdsCDSMSAD_210184.t1:cds:1126924..1126987 +
MSAD_210184.t1:cdsCDSMSAD_210184.t1:cds:1127315..1127454 +
MSAD_210184.t1:cdsCDSMSAD_210184.t1:cds:1128097..1128319 +
MSAD_210184.t1:cdsCDSMSAD_210184.t1:cds:1130605..1130726 +
MSAD_210184.t1:cdsCDSMSAD_210184.t1:cds:1132166..1132471 +
MSAD_210184.t1:cdsCDSMSAD_210184.t1:cds:1132573..1132636 +
MSAD_210184.t1:cdsCDSMSAD_210184.t1:cds:1132936..1133075 +
MSAD_210184.t1:cdsCDSMSAD_210184.t1:cds:1133171..1133479 +
MSAD_210184.t1:cdsCDSMSAD_210184.t1:cds:1133731..1134006 +
MSAD_210190geneMSAD_210190:1172036..1173089 +
MSAD_210190.t1mRNAMSAD_210190.t1:1172036..1173089 +
MSAD_210190.t1:exon:567exonMSAD_210190.t1:exon:567:1172036..1172236 +
MSAD_210190.t1:exon:568exonMSAD_210190.t1:exon:568:1172405..1173089 +
MSAD_210190.t1:cdsCDSMSAD_210190.t1:cds:1172095..1172236 +
MSAD_210190.t1:cdsCDSMSAD_210190.t1:cds:1172405..1172520 +
MSAD_210183geneMSAD_210183:1107553..1107963 +
MSAD_210183.t1mRNAMSAD_210183.t1:1107553..1107963 +
MSAD_210183.t1:exon:569exonMSAD_210183.t1:exon:569:1107553..1107963 +
MSAD_210183.t1:cdsCDSMSAD_210183.t1:cds:1107553..1107963 +
MSAD_210189geneMSAD_210189:1169039..1170391 +
MSAD_210189.t1mRNAMSAD_210189.t1:1169039..1170391 +
MSAD_210189.t1:exon:570exonMSAD_210189.t1:exon:570:1169039..1169297 +
MSAD_210189.t1:exon:571exonMSAD_210189.t1:exon:571:1170213..1170391 +
MSAD_210189.t1:cdsCDSMSAD_210189.t1:cds:1169141..1169297 +
MSAD_210189.t1:cdsCDSMSAD_210189.t1:cds:1170213..1170391 +
MSAD_210182geneMSAD_210182:1100043..1100796 -
MSAD_210182.t1mRNAMSAD_210182.t1:1100043..1100796 -
MSAD_210182.t1:exon:573exonMSAD_210182.t1:exon:573:1100743..1100796 -
MSAD_210182.t1:exon:572exonMSAD_210182.t1:exon:572:1100043..1100342 -
MSAD_210182.t1:cdsCDSMSAD_210182.t1:cds:1100743..1100796 -
MSAD_210182.t1:cdsCDSMSAD_210182.t1:cds:1100043..1100342 -
MSAD_210187geneMSAD_210187:1147394..1147652 -
MSAD_210187.t1mRNAMSAD_210187.t1:1147394..1147652 -
MSAD_210187.t1:exon:575exonMSAD_210187.t1:exon:575:1147461..1147652 -
MSAD_210187.t1:exon:574exonMSAD_210187.t1:exon:574:1147394..1147417 -
MSAD_210187.t1:cdsCDSMSAD_210187.t1:cds:1147461..1147652 -
MSAD_210187.t1:cdsCDSMSAD_210187.t1:cds:1147394..1147417 -
MSAD_210196geneMSAD_210196:1217092..1218214 +
MSAD_210196.t1mRNAMSAD_210196.t1:1217092..1218214 +
MSAD_210196.t1:exon:576exonMSAD_210196.t1:exon:576:1217092..1217370 +
MSAD_210196.t1:exon:577exonMSAD_210196.t1:exon:577:1217529..1218214 +
MSAD_210196.t1:cdsCDSMSAD_210196.t1:cds:1217208..1217370 +
MSAD_210196.t1:cdsCDSMSAD_210196.t1:cds:1217529..1217848 +
MSAD_210203geneMSAD_210203:1268844..1269560 +
MSAD_210203.t1mRNAMSAD_210203.t1:1268844..1269560 +
MSAD_210203.t1:exon:578exonMSAD_210203.t1:exon:578:1268844..1268927 +
MSAD_210203.t1:exon:579exonMSAD_210203.t1:exon:579:1269182..1269443 +
MSAD_210203.t1:exon:580exonMSAD_210203.t1:exon:580:1269478..1269560 +
MSAD_210203.t1:cdsCDSMSAD_210203.t1:cds:1268844..1268927 +
MSAD_210203.t1:cdsCDSMSAD_210203.t1:cds:1269182..1269443 +
MSAD_210203.t1:cdsCDSMSAD_210203.t1:cds:1269478..1269560 +
MSAD_210192geneMSAD_210192:1205620..1207463 +
MSAD_210192.t1mRNAMSAD_210192.t1:1205620..1207463 +
MSAD_210192.t1:exon:581exonMSAD_210192.t1:exon:581:1205620..1205649 +
MSAD_210192.t1:exon:582exonMSAD_210192.t1:exon:582:1205928..1206071 +
MSAD_210192.t1:exon:583exonMSAD_210192.t1:exon:583:1206150..1206245 +
MSAD_210192.t1:exon:584exonMSAD_210192.t1:exon:584:1207421..1207463 +
MSAD_210192.t1:cdsCDSMSAD_210192.t1:cds:1205620..1205649 +
MSAD_210192.t1:cdsCDSMSAD_210192.t1:cds:1205928..1206071 +
MSAD_210192.t1:cdsCDSMSAD_210192.t1:cds:1206150..1206245 +
MSAD_210192.t1:cdsCDSMSAD_210192.t1:cds:1207421..1207450 +
MSAD_210201geneMSAD_210201:1259894..1261485 +
MSAD_210201.t1mRNAMSAD_210201.t1:1259894..1261485 +
MSAD_210201.t1:exon:585exonMSAD_210201.t1:exon:585:1259894..1260211 +
MSAD_210201.t1:exon:586exonMSAD_210201.t1:exon:586:1261147..1261485 +
MSAD_210201.t1:cdsCDSMSAD_210201.t1:cds:1259894..1260211 +
MSAD_210201.t1:cdsCDSMSAD_210201.t1:cds:1261147..1261485 +
MSAD_210202geneMSAD_210202:1261576..1264028 +
MSAD_210202.t1mRNAMSAD_210202.t1:1261576..1264028 +
MSAD_210202.t1:exon:587exonMSAD_210202.t1:exon:587:1261576..1261695 +
MSAD_210202.t1:exon:588exonMSAD_210202.t1:exon:588:1263903..1264028 +
MSAD_210202.t1:cdsCDSMSAD_210202.t1:cds:1261576..1261695 +
MSAD_210202.t1:cdsCDSMSAD_210202.t1:cds:1263903..1264028 +
MSAD_210198geneMSAD_210198:1243489..1250001 -
MSAD_210198.t1mRNAMSAD_210198.t1:1243489..1250001 -
MSAD_210198.t1:exon:603exonMSAD_210198.t1:exon:603:1243489..1244045 -
MSAD_210198.t1:exon:602exonMSAD_210198.t1:exon:602:1244683..1244882 -
MSAD_210198.t1:exon:601exonMSAD_210198.t1:exon:601:1245001..1245191 -
MSAD_210198.t1:exon:600exonMSAD_210198.t1:exon:600:1246220..1246323 -
MSAD_210198.t1:exon:599exonMSAD_210198.t1:exon:599:1246512..1246711 -
MSAD_210198.t1:exon:598exonMSAD_210198.t1:exon:598:1246795..1246904 -
MSAD_210198.t1:exon:597exonMSAD_210198.t1:exon:597:1247274..1247487 -
MSAD_210198.t1:exon:596exonMSAD_210198.t1:exon:596:1247663..1247950 -
MSAD_210198.t1:exon:595exonMSAD_210198.t1:exon:595:1249165..1250001 -
MSAD_210198.t1:cdsCDSMSAD_210198.t1:cds:1249165..1249414 -
MSAD_210198.t1:cdsCDSMSAD_210198.t1:cds:1247663..1247950 -
MSAD_210198.t1:cdsCDSMSAD_210198.t1:cds:1247274..1247487 -
MSAD_210198.t1:cdsCDSMSAD_210198.t1:cds:1246795..1246904 -
MSAD_210198.t1:cdsCDSMSAD_210198.t1:cds:1246512..1246711 -
MSAD_210198.t1:cdsCDSMSAD_210198.t1:cds:1246220..1246323 -
MSAD_210198.t1:cdsCDSMSAD_210198.t1:cds:1245001..1245191 -
MSAD_210198.t1:cdsCDSMSAD_210198.t1:cds:1244683..1244882 -
MSAD_210198.t1:cdsCDSMSAD_210198.t1:cds:1243824..1244045 -
MSAD_210197geneMSAD_210197:1236147..1241492 -
MSAD_210197.t1mRNAMSAD_210197.t1:1236147..1241492 -
MSAD_210197.t1:exon:613exonMSAD_210197.t1:exon:613:1236147..1236578 -
MSAD_210197.t1:exon:612exonMSAD_210197.t1:exon:612:1236692..1236748 -
MSAD_210197.t1:exon:611exonMSAD_210197.t1:exon:611:1237026..1237133 -
MSAD_210197.t1:exon:610exonMSAD_210197.t1:exon:610:1237234..1237331 -
MSAD_210197.t1:exon:609exonMSAD_210197.t1:exon:609:1237432..1237476 -
MSAD_210197.t1:exon:608exonMSAD_210197.t1:exon:608:1237570..1237700 -
MSAD_210197.t1:exon:607exonMSAD_210197.t1:exon:607:1238006..1238139 -
MSAD_210197.t1:exon:606exonMSAD_210197.t1:exon:606:1238207..1238374 -
MSAD_210197.t1:exon:605exonMSAD_210197.t1:exon:605:1238787..1238863 -
MSAD_210197.t1:exon:604exonMSAD_210197.t1:exon:604:1241233..1241492 -
MSAD_210197.t1:cdsCDSMSAD_210197.t1:cds:1241233..1241359 -
MSAD_210197.t1:cdsCDSMSAD_210197.t1:cds:1238787..1238863 -
MSAD_210197.t1:cdsCDSMSAD_210197.t1:cds:1238207..1238374 -
MSAD_210197.t1:cdsCDSMSAD_210197.t1:cds:1238006..1238139 -
MSAD_210197.t1:cdsCDSMSAD_210197.t1:cds:1237570..1237700 -
MSAD_210197.t1:cdsCDSMSAD_210197.t1:cds:1237432..1237476 -
MSAD_210197.t1:cdsCDSMSAD_210197.t1:cds:1237234..1237331 -
MSAD_210197.t1:cdsCDSMSAD_210197.t1:cds:1237026..1237133 -
MSAD_210197.t1:cdsCDSMSAD_210197.t1:cds:1236692..1236748 -
MSAD_210197.t1:cdsCDSMSAD_210197.t1:cds:1236504..1236578 -
MSAD_210191geneMSAD_210191:1190262..1191285 -
MSAD_210191.t1mRNAMSAD_210191.t1:1190262..1191285 -
MSAD_210191.t1:exon:615exonMSAD_210191.t1:exon:615:1190262..1190407 -
MSAD_210191.t1:exon:614exonMSAD_210191.t1:exon:614:1191061..1191285 -
MSAD_210191.t1:cdsCDSMSAD_210191.t1:cds:1191061..1191181 -
MSAD_210191.t1:cdsCDSMSAD_210191.t1:cds:1190262..1190407 -
MSAD_210195geneMSAD_210195:1214145..1215891 -
MSAD_210195.t1mRNAMSAD_210195.t1:1214145..1215891 -
MSAD_210195.t1:exon:626exonMSAD_210195.t1:exon:626:1215843..1215891 -
MSAD_210195.t1:exon:625exonMSAD_210195.t1:exon:625:1215171..1215289 -
MSAD_210195.t1:exon:624exonMSAD_210195.t1:exon:624:1214145..1215035 -
MSAD_210195.t1:cdsCDSMSAD_210195.t1:cds:1215843..1215891 -
MSAD_210195.t1:cdsCDSMSAD_210195.t1:cds:1215171..1215289 -
MSAD_210195.t1:cdsCDSMSAD_210195.t1:cds:1214145..1215035 -
MSAD_210194geneMSAD_210194:1211312..1213520 +
MSAD_210194.t1mRNAMSAD_210194.t1:1211312..1213520 +
MSAD_210194.t1:exon:627exonMSAD_210194.t1:exon:627:1211312..1211607 +
MSAD_210194.t1:exon:628exonMSAD_210194.t1:exon:628:1213364..1213520 +
MSAD_210194.t1:cdsCDSMSAD_210194.t1:cds:1211312..1211607 +
MSAD_210194.t1:cdsCDSMSAD_210194.t1:cds:1213364..1213520 +
MSAD_210204geneMSAD_210204:1286522..1292772 +
MSAD_210204.t1mRNAMSAD_210204.t1:1286522..1292772 +
MSAD_210204.t1:exon:629exonMSAD_210204.t1:exon:629:1286522..1287697 +
MSAD_210204.t1:exon:630exonMSAD_210204.t1:exon:630:1288235..1288519 +
MSAD_210204.t1:exon:631exonMSAD_210204.t1:exon:631:1288775..1289092 +
MSAD_210204.t1:exon:632exonMSAD_210204.t1:exon:632:1289413..1289640 +
MSAD_210204.t1:exon:633exonMSAD_210204.t1:exon:633:1290147..1290247 +
MSAD_210204.t1:exon:634exonMSAD_210204.t1:exon:634:1290423..1290537 +
MSAD_210204.t1:exon:635exonMSAD_210204.t1:exon:635:1291134..1291604 +
MSAD_210204.t1:exon:636exonMSAD_210204.t1:exon:636:1292285..1292772 +
MSAD_210204.t1:cdsCDSMSAD_210204.t1:cds:1287281..1287697 +
MSAD_210204.t1:cdsCDSMSAD_210204.t1:cds:1288235..1288519 +
MSAD_210204.t1:cdsCDSMSAD_210204.t1:cds:1288775..1289092 +
MSAD_210204.t1:cdsCDSMSAD_210204.t1:cds:1289413..1289640 +
MSAD_210204.t1:cdsCDSMSAD_210204.t1:cds:1290147..1290247 +
MSAD_210204.t1:cdsCDSMSAD_210204.t1:cds:1290423..1290537 +
MSAD_210204.t1:cdsCDSMSAD_210204.t1:cds:1291134..1291604 +
MSAD_210204.t1:cdsCDSMSAD_210204.t1:cds:1292285..1292488 +
MSAD_210210geneMSAD_210210:1370803..1376777 +
MSAD_210210.t1mRNAMSAD_210210.t1:1370803..1376777 +
MSAD_210210.t1:exon:637exonMSAD_210210.t1:exon:637:1370803..1370988 +
MSAD_210210.t1:exon:638exonMSAD_210210.t1:exon:638:1371859..1372259 +
MSAD_210210.t1:exon:639exonMSAD_210210.t1:exon:639:1372887..1373072 +
MSAD_210210.t1:exon:640exonMSAD_210210.t1:exon:640:1373191..1373370 +
MSAD_210210.t1:exon:641exonMSAD_210210.t1:exon:641:1373487..1373681 +
MSAD_210210.t1:exon:642exonMSAD_210210.t1:exon:642:1374300..1374398 +
MSAD_210210.t1:exon:643exonMSAD_210210.t1:exon:643:1374552..1375040 +
MSAD_210210.t1:exon:644exonMSAD_210210.t1:exon:644:1375459..1376777 +
MSAD_210210.t1:cdsCDSMSAD_210210.t1:cds:1371885..1372259 +
MSAD_210210.t1:cdsCDSMSAD_210210.t1:cds:1372887..1373072 +
MSAD_210210.t1:cdsCDSMSAD_210210.t1:cds:1373191..1373370 +
MSAD_210210.t1:cdsCDSMSAD_210210.t1:cds:1373487..1373681 +
MSAD_210210.t1:cdsCDSMSAD_210210.t1:cds:1374300..1374398 +
MSAD_210210.t1:cdsCDSMSAD_210210.t1:cds:1374552..1375040 +
MSAD_210210.t1:cdsCDSMSAD_210210.t1:cds:1375459..1375764 +
MSAD_210205geneMSAD_210205:1310835..1316464 +
MSAD_210205.t1mRNAMSAD_210205.t1:1310835..1316464 +
MSAD_210205.t1:exon:645exonMSAD_210205.t1:exon:645:1310835..1311101 +
MSAD_210205.t1:exon:646exonMSAD_210205.t1:exon:646:1311300..1312340 +
MSAD_210205.t1:exon:647exonMSAD_210205.t1:exon:647:1312710..1312867 +
MSAD_210205.t1:exon:648exonMSAD_210205.t1:exon:648:1313335..1314271 +
MSAD_210205.t1:exon:649exonMSAD_210205.t1:exon:649:1314605..1314727 +
MSAD_210205.t1:exon:650exonMSAD_210205.t1:exon:650:1314855..1315196 +
MSAD_210205.t1:exon:651exonMSAD_210205.t1:exon:651:1315328..1315387 +
MSAD_210205.t1:exon:652exonMSAD_210205.t1:exon:652:1315574..1316464 +
MSAD_210205.t1:cdsCDSMSAD_210205.t1:cds:1311519..1312340 +
MSAD_210205.t1:cdsCDSMSAD_210205.t1:cds:1312710..1312867 +
MSAD_210205.t1:cdsCDSMSAD_210205.t1:cds:1313335..1314271 +
MSAD_210205.t1:cdsCDSMSAD_210205.t1:cds:1314605..1314727 +
MSAD_210205.t1:cdsCDSMSAD_210205.t1:cds:1314855..1315196 +
MSAD_210205.t1:cdsCDSMSAD_210205.t1:cds:1315328..1315387 +
MSAD_210205.t1:cdsCDSMSAD_210205.t1:cds:1315574..1315762 +
MSAD_210207geneMSAD_210207:1326103..1326816 -
MSAD_210207.t1mRNAMSAD_210207.t1:1326103..1326816 -
MSAD_210207.t1:exon:653exonMSAD_210207.t1:exon:653:1326103..1326816 -
MSAD_210207.t1:cdsCDSMSAD_210207.t1:cds:1326103..1326816 -
MSAD_210208geneMSAD_210208:1338100..1341872 -
MSAD_210208.t1mRNAMSAD_210208.t1:1338100..1341872 -
MSAD_210208.t1:exon:658exonMSAD_210208.t1:exon:658:1338100..1338999 -
MSAD_210208.t1:exon:657exonMSAD_210208.t1:exon:657:1339901..1340016 -
MSAD_210208.t1:exon:656exonMSAD_210208.t1:exon:656:1340147..1340222 -
MSAD_210208.t1:exon:655exonMSAD_210208.t1:exon:655:1340322..1341049 -
MSAD_210208.t1:exon:654exonMSAD_210208.t1:exon:654:1341636..1341872 -
MSAD_210208.t1:cdsCDSMSAD_210208.t1:cds:1340322..1340904 -
MSAD_210208.t1:cdsCDSMSAD_210208.t1:cds:1340147..1340222 -
MSAD_210208.t1:cdsCDSMSAD_210208.t1:cds:1339901..1340016 -
MSAD_210208.t1:cdsCDSMSAD_210208.t1:cds:1338500..1338999 -
MSAD_210211geneMSAD_210211:1386766..1388447 -
MSAD_210211.t1mRNAMSAD_210211.t1:1386766..1388447 -
MSAD_210211.t1:exon:662exonMSAD_210211.t1:exon:662:1388298..1388447 -
MSAD_210211.t1:exon:661exonMSAD_210211.t1:exon:661:1388073..1388203 -
MSAD_210211.t1:exon:660exonMSAD_210211.t1:exon:660:1387531..1387726 -
MSAD_210211.t1:exon:659exonMSAD_210211.t1:exon:659:1386766..1387056 -
MSAD_210211.t1:cdsCDSMSAD_210211.t1:cds:1388298..1388447 -
MSAD_210211.t1:cdsCDSMSAD_210211.t1:cds:1388073..1388203 -
MSAD_210211.t1:cdsCDSMSAD_210211.t1:cds:1387531..1387726 -
MSAD_210211.t1:cdsCDSMSAD_210211.t1:cds:1386766..1387056 -
MSAD_210209geneMSAD_210209:1348061..1350160 -
MSAD_210209.t1mRNAMSAD_210209.t1:1348061..1350160 -
MSAD_210209.t1:exon:665exonMSAD_210209.t1:exon:665:1348061..1348364 -
MSAD_210209.t1:exon:664exonMSAD_210209.t1:exon:664:1349707..1349752 -
MSAD_210209.t1:exon:663exonMSAD_210209.t1:exon:663:1349952..1350160 -
MSAD_210209.t1:cdsCDSMSAD_210209.t1:cds:1349952..1349964 -
MSAD_210209.t1:cdsCDSMSAD_210209.t1:cds:1349707..1349752 -
MSAD_210209.t1:cdsCDSMSAD_210209.t1:cds:1348061..1348364 -
MSAD_210206geneMSAD_210206:1319054..1319713 -
MSAD_210206.t1mRNAMSAD_210206.t1:1319054..1319713 -
MSAD_210206.t1:exon:667exonMSAD_210206.t1:exon:667:1319645..1319713 -
MSAD_210206.t1:exon:666exonMSAD_210206.t1:exon:666:1319054..1319539 -
MSAD_210206.t1:cdsCDSMSAD_210206.t1:cds:1319645..1319713 -
MSAD_210206.t1:cdsCDSMSAD_210206.t1:cds:1319054..1319539 -
MSAD_210212geneMSAD_210212:1418527..1422472 +
MSAD_210212.t1mRNAMSAD_210212.t1:1418527..1422472 +
MSAD_210212.t1:exon:668exonMSAD_210212.t1:exon:668:1418527..1419025 +
MSAD_210212.t1:exon:669exonMSAD_210212.t1:exon:669:1419444..1421194 +
MSAD_210212.t1:exon:670exonMSAD_210212.t1:exon:670:1421958..1422472 +
MSAD_210212.t1:cdsCDSMSAD_210212.t1:cds:1418696..1419025 +
MSAD_210212.t1:cdsCDSMSAD_210212.t1:cds:1419444..1421194 +
MSAD_210212.t1:cdsCDSMSAD_210212.t1:cds:1421958..1422105 +
MSAD_210213geneMSAD_210213:1425308..1465986 +
MSAD_210213.t1mRNAMSAD_210213.t1:1425308..1465986 +
MSAD_210213.t1:exon:671exonMSAD_210213.t1:exon:671:1425308..1425733 +
MSAD_210213.t1:exon:672exonMSAD_210213.t1:exon:672:1425742..1425909 +
MSAD_210213.t1:exon:673exonMSAD_210213.t1:exon:673:1427952..1428551 +
MSAD_210213.t1:exon:674exonMSAD_210213.t1:exon:674:1429690..1429978 +
MSAD_210213.t1:exon:675exonMSAD_210213.t1:exon:675:1459498..1461483 +
MSAD_210213.t1:exon:676exonMSAD_210213.t1:exon:676:1461676..1462004 +
MSAD_210213.t1:exon:677exonMSAD_210213.t1:exon:677:1465732..1465986 +
MSAD_210213.t1:cdsCDSMSAD_210213.t1:cds:1425308..1425733 +
MSAD_210213.t1:cdsCDSMSAD_210213.t1:cds:1425742..1425909 +
MSAD_210213.t1:cdsCDSMSAD_210213.t1:cds:1427952..1428551 +
MSAD_210213.t1:cdsCDSMSAD_210213.t1:cds:1429690..1429978 +
MSAD_210213.t1:cdsCDSMSAD_210213.t1:cds:1459498..1461483 +
MSAD_210213.t1:cdsCDSMSAD_210213.t1:cds:1461676..1462004 +
MSAD_210213.t1:cdsCDSMSAD_210213.t1:cds:1465732..1465986 +
MSAD_210214geneMSAD_210214:1445381..1446081 -
MSAD_210214.t1mRNAMSAD_210214.t1:1445381..1446081 -
MSAD_210214.t1:exon:681exonMSAD_210214.t1:exon:681:1446019..1446081 -
MSAD_210214.t1:exon:680exonMSAD_210214.t1:exon:680:1445890..1445985 -
MSAD_210214.t1:exon:679exonMSAD_210214.t1:exon:679:1445544..1445665 -
MSAD_210214.t1:exon:678exonMSAD_210214.t1:exon:678:1445381..1445441 -
MSAD_210214.t1:cdsCDSMSAD_210214.t1:cds:1446019..1446081 -
MSAD_210214.t1:cdsCDSMSAD_210214.t1:cds:1445890..1445985 -
MSAD_210214.t1:cdsCDSMSAD_210214.t1:cds:1445544..1445665 -
MSAD_210214.t1:cdsCDSMSAD_210214.t1:cds:1445381..1445441 -
MSAD_210216geneMSAD_210216:1510904..1517737 +
MSAD_210216.t1mRNAMSAD_210216.t1:1510904..1517737 +
MSAD_210216.t1:exon:682exonMSAD_210216.t1:exon:682:1510904..1511147 +
MSAD_210216.t1:exon:683exonMSAD_210216.t1:exon:683:1513055..1513164 +
MSAD_210216.t1:exon:684exonMSAD_210216.t1:exon:684:1513377..1513508 +
MSAD_210216.t1:exon:685exonMSAD_210216.t1:exon:685:1513603..1513676 +
MSAD_210216.t1:exon:686exonMSAD_210216.t1:exon:686:1513774..1513879 +
MSAD_210216.t1:exon:687exonMSAD_210216.t1:exon:687:1514669..1514737 +
MSAD_210216.t1:exon:688exonMSAD_210216.t1:exon:688:1516069..1516133 +
MSAD_210216.t1:exon:689exonMSAD_210216.t1:exon:689:1516227..1516325 +
MSAD_210216.t1:exon:690exonMSAD_210216.t1:exon:690:1517019..1517118 +
MSAD_210216.t1:exon:691exonMSAD_210216.t1:exon:691:1517227..1517737 +
MSAD_210216.t1:cdsCDSMSAD_210216.t1:cds:1510988..1511147 +
MSAD_210216.t1:cdsCDSMSAD_210216.t1:cds:1513055..1513164 +
MSAD_210216.t1:cdsCDSMSAD_210216.t1:cds:1513377..1513508 +
MSAD_210216.t1:cdsCDSMSAD_210216.t1:cds:1513603..1513676 +
MSAD_210216.t1:cdsCDSMSAD_210216.t1:cds:1513774..1513879 +
MSAD_210216.t1:cdsCDSMSAD_210216.t1:cds:1514669..1514737 +
MSAD_210216.t1:cdsCDSMSAD_210216.t1:cds:1516069..1516133 +
MSAD_210216.t1:cdsCDSMSAD_210216.t1:cds:1516227..1516325 +
MSAD_210216.t1:cdsCDSMSAD_210216.t1:cds:1517019..1517118 +
MSAD_210216.t1:cdsCDSMSAD_210216.t1:cds:1517227..1517289 +
MSAD_210225geneMSAD_210225:1588775..1589114 +
MSAD_210225.t1mRNAMSAD_210225.t1:1588775..1589114 +
MSAD_210225.t1:exon:692exonMSAD_210225.t1:exon:692:1588775..1588932 +
MSAD_210225.t1:exon:693exonMSAD_210225.t1:exon:693:1589018..1589114 +
MSAD_210225.t1:cdsCDSMSAD_210225.t1:cds:1588775..1588932 +
MSAD_210225.t1:cdsCDSMSAD_210225.t1:cds:1589018..1589114 +
MSAD_210222geneMSAD_210222:1566030..1566776 +
MSAD_210222.t1mRNAMSAD_210222.t1:1566030..1566776 +
MSAD_210222.t1:exon:694exonMSAD_210222.t1:exon:694:1566030..1566776 +
MSAD_210222.t1:cdsCDSMSAD_210222.t1:cds:1566030..1566776 +
MSAD_210221geneMSAD_210221:1539710..1540490 +
MSAD_210221.t1mRNAMSAD_210221.t1:1539710..1540490 +
MSAD_210221.t1:exon:695exonMSAD_210221.t1:exon:695:1539710..1539891 +
MSAD_210221.t1:exon:696exonMSAD_210221.t1:exon:696:1540024..1540154 +
MSAD_210221.t1:exon:697exonMSAD_210221.t1:exon:697:1540234..1540393 +
MSAD_210221.t1:exon:698exonMSAD_210221.t1:exon:698:1540457..1540490 +
MSAD_210221.t1:cdsCDSMSAD_210221.t1:cds:1539710..1539891 +
MSAD_210221.t1:cdsCDSMSAD_210221.t1:cds:1540024..1540154 +
MSAD_210221.t1:cdsCDSMSAD_210221.t1:cds:1540234..1540393 +
MSAD_210221.t1:cdsCDSMSAD_210221.t1:cds:1540457..1540490 +
MSAD_210219geneMSAD_210219:1530943..1531703 -
MSAD_210219.t1mRNAMSAD_210219.t1:1530943..1531703 -
MSAD_210219.t1:exon:700exonMSAD_210219.t1:exon:700:1530943..1531347 -
MSAD_210219.t1:exon:699exonMSAD_210219.t1:exon:699:1531451..1531703 -
MSAD_210219.t1:cdsCDSMSAD_210219.t1:cds:1531451..1531541 -
MSAD_210219.t1:cdsCDSMSAD_210219.t1:cds:1531163..1531347 -
MSAD_210223geneMSAD_210223:1570882..1580115 -
MSAD_210223.t1mRNAMSAD_210223.t1:1570882..1580115 -
MSAD_210223.t1:exon:712exonMSAD_210223.t1:exon:712:1570882..1571387 -
MSAD_210223.t1:exon:711exonMSAD_210223.t1:exon:711:1572135..1572253 -
MSAD_210223.t1:exon:710exonMSAD_210223.t1:exon:710:1572327..1572436 -
MSAD_210223.t1:exon:709exonMSAD_210223.t1:exon:709:1573288..1573389 -
MSAD_210223.t1:exon:708exonMSAD_210223.t1:exon:708:1573468..1573617 -
MSAD_210223.t1:exon:707exonMSAD_210223.t1:exon:707:1574898..1575053 -
MSAD_210223.t1:exon:706exonMSAD_210223.t1:exon:706:1575263..1575439 -
MSAD_210223.t1:exon:705exonMSAD_210223.t1:exon:705:1575611..1575700 -
MSAD_210223.t1:exon:704exonMSAD_210223.t1:exon:704:1575827..1575946 -
MSAD_210223.t1:exon:703exonMSAD_210223.t1:exon:703:1577009..1577104 -
MSAD_210223.t1:exon:702exonMSAD_210223.t1:exon:702:1577818..1577954 -
MSAD_210223.t1:exon:701exonMSAD_210223.t1:exon:701:1579771..1580115 -
MSAD_210223.t1:cdsCDSMSAD_210223.t1:cds:1579771..1579993 -
MSAD_210223.t1:cdsCDSMSAD_210223.t1:cds:1577818..1577954 -
MSAD_210223.t1:cdsCDSMSAD_210223.t1:cds:1577009..1577104 -
MSAD_210223.t1:cdsCDSMSAD_210223.t1:cds:1575827..1575946 -
MSAD_210223.t1:cdsCDSMSAD_210223.t1:cds:1575611..1575700 -
MSAD_210223.t1:cdsCDSMSAD_210223.t1:cds:1575263..1575439 -
MSAD_210223.t1:cdsCDSMSAD_210223.t1:cds:1574898..1575053 -
MSAD_210223.t1:cdsCDSMSAD_210223.t1:cds:1573468..1573617 -
MSAD_210223.t1:cdsCDSMSAD_210223.t1:cds:1573288..1573389 -
MSAD_210223.t1:cdsCDSMSAD_210223.t1:cds:1572327..1572436 -
MSAD_210223.t1:cdsCDSMSAD_210223.t1:cds:1572135..1572253 -
MSAD_210223.t1:cdsCDSMSAD_210223.t1:cds:1571296..1571387 -
MSAD_210224geneMSAD_210224:1581294..1583388 -
MSAD_210224.t1mRNAMSAD_210224.t1:1581294..1583388 -
MSAD_210224.t1:exon:715exonMSAD_210224.t1:exon:715:1583107..1583388 -
MSAD_210224.t1:exon:714exonMSAD_210224.t1:exon:714:1582379..1582497 -
MSAD_210224.t1:exon:713exonMSAD_210224.t1:exon:713:1581294..1581714 -
MSAD_210224.t1:cdsCDSMSAD_210224.t1:cds:1583107..1583388 -
MSAD_210224.t1:cdsCDSMSAD_210224.t1:cds:1582379..1582497 -
MSAD_210224.t1:cdsCDSMSAD_210224.t1:cds:1581294..1581714 -
MSAD_210215geneMSAD_210215:1501947..1506468 -
MSAD_210215.t1mRNAMSAD_210215.t1:1501947..1506468 -
MSAD_210215.t1:exon:719exonMSAD_210215.t1:exon:719:1506407..1506468 -
MSAD_210215.t1:exon:718exonMSAD_210215.t1:exon:718:1506101..1506294 -
MSAD_210215.t1:exon:717exonMSAD_210215.t1:exon:717:1505282..1505836 -
MSAD_210215.t1:exon:716exonMSAD_210215.t1:exon:716:1501947..1502026 -
MSAD_210215.t1:cdsCDSMSAD_210215.t1:cds:1506407..1506468 -
MSAD_210215.t1:cdsCDSMSAD_210215.t1:cds:1506101..1506294 -
MSAD_210215.t1:cdsCDSMSAD_210215.t1:cds:1505282..1505836 -
MSAD_210215.t1:cdsCDSMSAD_210215.t1:cds:1501947..1502026 -
MSAD_210217geneMSAD_210217:1519968..1525202 -
MSAD_210217.t1mRNAMSAD_210217.t1:1519968..1525202 -
MSAD_210217.t1:exon:722exonMSAD_210217.t1:exon:722:1524822..1525202 -
MSAD_210217.t1:exon:721exonMSAD_210217.t1:exon:721:1520452..1520879 -
MSAD_210217.t1:exon:720exonMSAD_210217.t1:exon:720:1519968..1520061 -
MSAD_210217.t1:cdsCDSMSAD_210217.t1:cds:1524822..1525202 -
MSAD_210217.t1:cdsCDSMSAD_210217.t1:cds:1520452..1520879 -
MSAD_210217.t1:cdsCDSMSAD_210217.t1:cds:1519968..1520061 -
MSAD_210218geneMSAD_210218:1530199..1530887 +
MSAD_210218.t1mRNAMSAD_210218.t1:1530199..1530887 +
MSAD_210218.t1:exon:723exonMSAD_210218.t1:exon:723:1530199..1530274 +
MSAD_210218.t1:exon:724exonMSAD_210218.t1:exon:724:1530313..1530625 +
MSAD_210218.t1:exon:725exonMSAD_210218.t1:exon:725:1530634..1530778 +
MSAD_210218.t1:exon:726exonMSAD_210218.t1:exon:726:1530840..1530887 +
MSAD_210218.t1:cdsCDSMSAD_210218.t1:cds:1530199..1530274 +
MSAD_210218.t1:cdsCDSMSAD_210218.t1:cds:1530313..1530625 +
MSAD_210218.t1:cdsCDSMSAD_210218.t1:cds:1530634..1530778 +
MSAD_210218.t1:cdsCDSMSAD_210218.t1:cds:1530840..1530887 +
MSAD_210220geneMSAD_210220:1537073..1539439 +
MSAD_210220.t1mRNAMSAD_210220.t1:1537073..1539439 +
MSAD_210220.t1:exon:727exonMSAD_210220.t1:exon:727:1537073..1537176 +
MSAD_210220.t1:exon:728exonMSAD_210220.t1:exon:728:1537864..1537941 +
MSAD_210220.t1:exon:729exonMSAD_210220.t1:exon:729:1539218..1539439 +
MSAD_210220.t1:cdsCDSMSAD_210220.t1:cds:1537075..1537176 +
MSAD_210220.t1:cdsCDSMSAD_210220.t1:cds:1537864..1537941 +
MSAD_210220.t1:cdsCDSMSAD_210220.t1:cds:1539218..1539439 +
MSAD_210233geneMSAD_210233:1652183..1655399 +
MSAD_210233.t1mRNAMSAD_210233.t1:1652183..1655399 +
MSAD_210233.t1:exon:730exonMSAD_210233.t1:exon:730:1652183..1652207 +
MSAD_210233.t1:exon:731exonMSAD_210233.t1:exon:731:1652331..1652430 +
MSAD_210233.t1:exon:732exonMSAD_210233.t1:exon:732:1652806..1652813 +
MSAD_210233.t1:exon:733exonMSAD_210233.t1:exon:733:1653458..1653495 +
MSAD_210233.t1:exon:734exonMSAD_210233.t1:exon:734:1654221..1655399 +
MSAD_210233.t1:cdsCDSMSAD_210233.t1:cds:1652183..1652207 +
MSAD_210233.t1:cdsCDSMSAD_210233.t1:cds:1652331..1652430 +
MSAD_210233.t1:cdsCDSMSAD_210233.t1:cds:1652806..1652813 +
MSAD_210233.t1:cdsCDSMSAD_210233.t1:cds:1653458..1653495 +
MSAD_210233.t1:cdsCDSMSAD_210233.t1:cds:1654221..1655237 +
MSAD_210226geneMSAD_210226:1598007..1599708 +
MSAD_210226.t1mRNAMSAD_210226.t1:1598007..1599708 +
MSAD_210226.t1:exon:735exonMSAD_210226.t1:exon:735:1598007..1598244 +
MSAD_210226.t1:exon:736exonMSAD_210226.t1:exon:736:1598505..1598726 +
MSAD_210226.t1:exon:737exonMSAD_210226.t1:exon:737:1598830..1598975 +
MSAD_210226.t1:exon:738exonMSAD_210226.t1:exon:738:1599100..1599373 +
MSAD_210226.t1:exon:739exonMSAD_210226.t1:exon:739:1599506..1599708 +
MSAD_210226.t1:cdsCDSMSAD_210226.t1:cds:1598007..1598244 +
MSAD_210226.t1:cdsCDSMSAD_210226.t1:cds:1598505..1598726 +
MSAD_210226.t1:cdsCDSMSAD_210226.t1:cds:1598830..1598975 +
MSAD_210226.t1:cdsCDSMSAD_210226.t1:cds:1599100..1599373 +
MSAD_210226.t1:cdsCDSMSAD_210226.t1:cds:1599506..1599708 +
MSAD_210236geneMSAD_210236:1680766..1681119 +
MSAD_210236.t1mRNAMSAD_210236.t1:1680766..1681119 +
MSAD_210236.t1:exon:740exonMSAD_210236.t1:exon:740:1680766..1681023 +
MSAD_210236.t1:exon:741exonMSAD_210236.t1:exon:741:1681045..1681119 +
MSAD_210236.t1:cdsCDSMSAD_210236.t1:cds:1680766..1681023 +
MSAD_210236.t1:cdsCDSMSAD_210236.t1:cds:1681045..1681119 +
MSAD_210228geneMSAD_210228:1616627..1619915 +
MSAD_210228.t1mRNAMSAD_210228.t1:1616627..1619915 +
MSAD_210228.t1:exon:742exonMSAD_210228.t1:exon:742:1616627..1616679 +
MSAD_210228.t1:exon:743exonMSAD_210228.t1:exon:743:1617208..1617361 +
MSAD_210228.t1:exon:744exonMSAD_210228.t1:exon:744:1619160..1619915 +
MSAD_210228.t1:cdsCDSMSAD_210228.t1:cds:1616627..1616679 +
MSAD_210228.t1:cdsCDSMSAD_210228.t1:cds:1617208..1617361 +
MSAD_210228.t1:cdsCDSMSAD_210228.t1:cds:1619160..1619315 +
MSAD_210235geneMSAD_210235:1680441..1680731 +
MSAD_210235.t1mRNAMSAD_210235.t1:1680441..1680731 +
MSAD_210235.t1:exon:745exonMSAD_210235.t1:exon:745:1680441..1680731 +
MSAD_210235.t1:cdsCDSMSAD_210235.t1:cds:1680441..1680731 +
MSAD_210230geneMSAD_210230:1629334..1638594 +
MSAD_210230.t1mRNAMSAD_210230.t1:1629334..1638594 +
MSAD_210230.t1:exon:746exonMSAD_210230.t1:exon:746:1629334..1629340 +
MSAD_210230.t1:exon:747exonMSAD_210230.t1:exon:747:1629835..1629863 +
MSAD_210230.t1:exon:748exonMSAD_210230.t1:exon:748:1629929..1629979 +
MSAD_210230.t1:exon:749exonMSAD_210230.t1:exon:749:1630026..1630068 +
MSAD_210230.t1:exon:750exonMSAD_210230.t1:exon:750:1630164..1630234 +
MSAD_210230.t1:exon:751exonMSAD_210230.t1:exon:751:1630629..1630648 +
MSAD_210230.t1:exon:752exonMSAD_210230.t1:exon:752:1630693..1630828 +
MSAD_210230.t1:exon:753exonMSAD_210230.t1:exon:753:1630930..1630987 +
MSAD_210230.t1:exon:754exonMSAD_210230.t1:exon:754:1631645..1631880 +
MSAD_210230.t1:exon:755exonMSAD_210230.t1:exon:755:1631886..1632256 +
MSAD_210230.t1:exon:756exonMSAD_210230.t1:exon:756:1632351..1632399 +
MSAD_210230.t1:exon:757exonMSAD_210230.t1:exon:757:1632895..1633017 +
MSAD_210230.t1:exon:758exonMSAD_210230.t1:exon:758:1633050..1633091 +
MSAD_210230.t1:exon:759exonMSAD_210230.t1:exon:759:1633765..1633797 +
MSAD_210230.t1:exon:760exonMSAD_210230.t1:exon:760:1633989..1634057 +
MSAD_210230.t1:exon:761exonMSAD_210230.t1:exon:761:1634368..1634505 +
MSAD_210230.t1:exon:762exonMSAD_210230.t1:exon:762:1636741..1636896 +
MSAD_210230.t1:exon:763exonMSAD_210230.t1:exon:763:1638577..1638594 +
MSAD_210230.t1:cdsCDSMSAD_210230.t1:cds:1629334..1629340 +
MSAD_210230.t1:cdsCDSMSAD_210230.t1:cds:1629835..1629863 +
MSAD_210230.t1:cdsCDSMSAD_210230.t1:cds:1629929..1629979 +
MSAD_210230.t1:cdsCDSMSAD_210230.t1:cds:1630026..1630068 +
MSAD_210230.t1:cdsCDSMSAD_210230.t1:cds:1630164..1630234 +
MSAD_210230.t1:cdsCDSMSAD_210230.t1:cds:1630629..1630648 +
MSAD_210230.t1:cdsCDSMSAD_210230.t1:cds:1630693..1630828 +
MSAD_210230.t1:cdsCDSMSAD_210230.t1:cds:1630930..1630987 +
MSAD_210230.t1:cdsCDSMSAD_210230.t1:cds:1631645..1631880 +
MSAD_210230.t1:cdsCDSMSAD_210230.t1:cds:1631886..1632256 +
MSAD_210230.t1:cdsCDSMSAD_210230.t1:cds:1632351..1632399 +
MSAD_210230.t1:cdsCDSMSAD_210230.t1:cds:1632895..1633017 +
MSAD_210230.t1:cdsCDSMSAD_210230.t1:cds:1633050..1633091 +
MSAD_210230.t1:cdsCDSMSAD_210230.t1:cds:1633765..1633797 +
MSAD_210230.t1:cdsCDSMSAD_210230.t1:cds:1633989..1634057 +
MSAD_210230.t1:cdsCDSMSAD_210230.t1:cds:1634368..1634505 +
MSAD_210230.t1:cdsCDSMSAD_210230.t1:cds:1636741..1636896 +
MSAD_210230.t1:cdsCDSMSAD_210230.t1:cds:1638577..1638594 +
MSAD_210229geneMSAD_210229:1628745..1629332 +
MSAD_210229.t1mRNAMSAD_210229.t1:1628745..1629332 +
MSAD_210229.t1:exon:764exonMSAD_210229.t1:exon:764:1628745..1629072 +
MSAD_210229.t1:exon:765exonMSAD_210229.t1:exon:765:1629185..1629207 +
MSAD_210229.t1:exon:766exonMSAD_210229.t1:exon:766:1629278..1629332 +
MSAD_210229.t1:cdsCDSMSAD_210229.t1:cds:1628848..1629072 +
MSAD_210229.t1:cdsCDSMSAD_210229.t1:cds:1629185..1629207 +
MSAD_210229.t1:cdsCDSMSAD_210229.t1:cds:1629278..1629332 +
MSAD_210232geneMSAD_210232:1640192..1640710 +
MSAD_210232.t1mRNAMSAD_210232.t1:1640192..1640710 +
MSAD_210232.t1:exon:767exonMSAD_210232.t1:exon:767:1640192..1640710 +
MSAD_210232.t1:cdsCDSMSAD_210232.t1:cds:1640192..1640710 +
MSAD_210227geneMSAD_210227:1606294..1611735 -
MSAD_210227.t1mRNAMSAD_210227.t1:1606294..1611735 -
MSAD_210227.t1:exon:772exonMSAD_210227.t1:exon:772:1606294..1606839 -
MSAD_210227.t1:exon:771exonMSAD_210227.t1:exon:771:1606929..1607003 -
MSAD_210227.t1:exon:770exonMSAD_210227.t1:exon:770:1610322..1610423 -
MSAD_210227.t1:exon:769exonMSAD_210227.t1:exon:769:1611027..1611107 -
MSAD_210227.t1:exon:768exonMSAD_210227.t1:exon:768:1611196..1611735 -
MSAD_210227.t1:cdsCDSMSAD_210227.t1:cds:1611196..1611735 -
MSAD_210227.t1:cdsCDSMSAD_210227.t1:cds:1611027..1611107 -
MSAD_210227.t1:cdsCDSMSAD_210227.t1:cds:1610322..1610423 -
MSAD_210227.t1:cdsCDSMSAD_210227.t1:cds:1606929..1607003 -
MSAD_210227.t1:cdsCDSMSAD_210227.t1:cds:1606720..1606839 -
MSAD_210231geneMSAD_210231:1639117..1642856 -
MSAD_210231.t1mRNAMSAD_210231.t1:1639117..1642856 -
MSAD_210231.t1:exon:776exonMSAD_210231.t1:exon:776:1639117..1639159 -
MSAD_210231.t1:exon:775exonMSAD_210231.t1:exon:775:1639951..1640673 -
MSAD_210231.t1:exon:774exonMSAD_210231.t1:exon:774:1641040..1642381 -
MSAD_210231.t1:exon:773exonMSAD_210231.t1:exon:773:1642476..1642856 -
MSAD_210231.t1:cdsCDSMSAD_210231.t1:cds:1642476..1642644 -
MSAD_210231.t1:cdsCDSMSAD_210231.t1:cds:1641040..1642381 -
MSAD_210231.t1:cdsCDSMSAD_210231.t1:cds:1639951..1640673 -
MSAD_210231.t1:cdsCDSMSAD_210231.t1:cds:1639117..1639159 -
MSAD_210246geneMSAD_210246:1804926..1805270 +
MSAD_210246.t1mRNAMSAD_210246.t1:1804926..1805270 +
MSAD_210246.t1:exon:777exonMSAD_210246.t1:exon:777:1804926..1805270 +
MSAD_210246.t1:cdsCDSMSAD_210246.t1:cds:1804926..1805270 +
MSAD_210248geneMSAD_210248:1820352..1824833 +
MSAD_210248.t1mRNAMSAD_210248.t1:1820352..1824833 +
MSAD_210248.t1:exon:778exonMSAD_210248.t1:exon:778:1820352..1820612 +
MSAD_210248.t1:exon:779exonMSAD_210248.t1:exon:779:1821534..1821565 +
MSAD_210248.t1:exon:780exonMSAD_210248.t1:exon:780:1821898..1821918 +
MSAD_210248.t1:exon:781exonMSAD_210248.t1:exon:781:1823075..1823246 +
MSAD_210248.t1:exon:782exonMSAD_210248.t1:exon:782:1823410..1823455 +
MSAD_210248.t1:exon:783exonMSAD_210248.t1:exon:783:1823603..1823656 +
MSAD_210248.t1:exon:784exonMSAD_210248.t1:exon:784:1824516..1824833 +
MSAD_210248.t1:cdsCDSMSAD_210248.t1:cds:1820609..1820612 +
MSAD_210248.t1:cdsCDSMSAD_210248.t1:cds:1821534..1821565 +
MSAD_210248.t1:cdsCDSMSAD_210248.t1:cds:1821898..1821918 +
MSAD_210248.t1:cdsCDSMSAD_210248.t1:cds:1823075..1823246 +
MSAD_210248.t1:cdsCDSMSAD_210248.t1:cds:1823410..1823455 +
MSAD_210248.t1:cdsCDSMSAD_210248.t1:cds:1823603..1823656 +
MSAD_210248.t1:cdsCDSMSAD_210248.t1:cds:1824516..1824630 +
MSAD_210239geneMSAD_210239:1691639..1692214 +
MSAD_210239.t1mRNAMSAD_210239.t1:1691639..1692214 +
MSAD_210239.t1:exon:785exonMSAD_210239.t1:exon:785:1691639..1692214 +
MSAD_210239.t1:cdsCDSMSAD_210239.t1:cds:1691639..1692214 +
MSAD_210238geneMSAD_210238:1691312..1691584 +
MSAD_210238.t1mRNAMSAD_210238.t1:1691312..1691584 +
MSAD_210238.t1:exon:788exonMSAD_210238.t1:exon:788:1691312..1691584 +
MSAD_210238.t1:cdsCDSMSAD_210238.t1:cds:1691312..1691584 +
MSAD_210241geneMSAD_210241:1735250..1738814 +
MSAD_210241.t1mRNAMSAD_210241.t1:1735250..1738814 +
MSAD_210241.t1:exon:789exonMSAD_210241.t1:exon:789:1735250..1735395 +
MSAD_210241.t1:exon:790exonMSAD_210241.t1:exon:790:1735687..1735707 +
MSAD_210241.t1:exon:791exonMSAD_210241.t1:exon:791:1735765..1735823 +
MSAD_210241.t1:exon:792exonMSAD_210241.t1:exon:792:1736944..1737007 +
MSAD_210241.t1:exon:793exonMSAD_210241.t1:exon:793:1738733..1738814 +
MSAD_210241.t1:cdsCDSMSAD_210241.t1:cds:1735250..1735395 +
MSAD_210241.t1:cdsCDSMSAD_210241.t1:cds:1735687..1735707 +
MSAD_210241.t1:cdsCDSMSAD_210241.t1:cds:1735765..1735823 +
MSAD_210241.t1:cdsCDSMSAD_210241.t1:cds:1736944..1737007 +
MSAD_210241.t1:cdsCDSMSAD_210241.t1:cds:1738733..1738814 +
MSAD_210240geneMSAD_210240:1733459..1733638 -
MSAD_210240.t1mRNAMSAD_210240.t1:1733459..1733638 -
MSAD_210240.t1:exon:794exonMSAD_210240.t1:exon:794:1733459..1733638 -
MSAD_210240.t1:cdsCDSMSAD_210240.t1:cds:1733459..1733638 -
MSAD_210249geneMSAD_210249:1827997..1829202 -
MSAD_210249.t1mRNAMSAD_210249.t1:1827997..1829202 -
MSAD_210249.t1:exon:795exonMSAD_210249.t1:exon:795:1827997..1829202 -
MSAD_210249.t1:cdsCDSMSAD_210249.t1:cds:1827997..1829202 -
MSAD_210250geneMSAD_210250:1850739..1853917 -
MSAD_210250.t1mRNAMSAD_210250.t1:1850739..1853917 -
MSAD_210250.t1:exon:801exonMSAD_210250.t1:exon:801:1850739..1851013 -
MSAD_210250.t1:exon:800exonMSAD_210250.t1:exon:800:1851240..1851395 -
MSAD_210250.t1:exon:799exonMSAD_210250.t1:exon:799:1851512..1851556 -
MSAD_210250.t1:exon:798exonMSAD_210250.t1:exon:798:1852385..1852629 -
MSAD_210250.t1:exon:797exonMSAD_210250.t1:exon:797:1853082..1853251 -
MSAD_210250.t1:exon:796exonMSAD_210250.t1:exon:796:1853410..1853917 -
MSAD_210250.t1:cdsCDSMSAD_210250.t1:cds:1853410..1853504 -
MSAD_210250.t1:cdsCDSMSAD_210250.t1:cds:1853082..1853251 -
MSAD_210250.t1:cdsCDSMSAD_210250.t1:cds:1852385..1852629 -
MSAD_210250.t1:cdsCDSMSAD_210250.t1:cds:1851512..1851556 -
MSAD_210250.t1:cdsCDSMSAD_210250.t1:cds:1851240..1851395 -
MSAD_210250.t1:cdsCDSMSAD_210250.t1:cds:1850915..1851013 -
MSAD_210242geneMSAD_210242:1739506..1742932 -
MSAD_210242.t1mRNAMSAD_210242.t1:1739506..1742932 -
MSAD_210242.t1:exon:804exonMSAD_210242.t1:exon:804:1739506..1740829 -
MSAD_210242.t1:exon:803exonMSAD_210242.t1:exon:803:1741801..1742163 -
MSAD_210242.t1:exon:802exonMSAD_210242.t1:exon:802:1742255..1742932 -
MSAD_210242.t1:cdsCDSMSAD_210242.t1:cds:1742255..1742932 -
MSAD_210242.t1:cdsCDSMSAD_210242.t1:cds:1741801..1742163 -
MSAD_210242.t1:cdsCDSMSAD_210242.t1:cds:1740716..1740829 -
MSAD_210237geneMSAD_210237:1689735..1722487 -
MSAD_210237.t1mRNAMSAD_210237.t1:1689735..1722487 -
MSAD_210237.t1:exon:825exonMSAD_210237.t1:exon:825:1689735..1689770 -
MSAD_210237.t1:exon:824exonMSAD_210237.t1:exon:824:1692775..1692900 -
MSAD_210237.t1:exon:823exonMSAD_210237.t1:exon:823:1693015..1693133 -
MSAD_210237.t1:exon:822exonMSAD_210237.t1:exon:822:1693227..1693465 -
MSAD_210237.t1:exon:821exonMSAD_210237.t1:exon:821:1693740..1693796 -
MSAD_210237.t1:exon:820exonMSAD_210237.t1:exon:820:1694652..1695202 -
MSAD_210237.t1:exon:819exonMSAD_210237.t1:exon:819:1696173..1696547 -
MSAD_210237.t1:exon:818exonMSAD_210237.t1:exon:818:1700223..1700345 -
MSAD_210237.t1:exon:817exonMSAD_210237.t1:exon:817:1700985..1701103 -
MSAD_210237.t1:exon:816exonMSAD_210237.t1:exon:816:1701206..1701444 -
MSAD_210237.t1:exon:815exonMSAD_210237.t1:exon:815:1701706..1701762 -
MSAD_210237.t1:exon:814exonMSAD_210237.t1:exon:814:1701849..1701928 -
MSAD_210237.t1:exon:813exonMSAD_210237.t1:exon:813:1702400..1702939 -
MSAD_210237.t1:exon:812exonMSAD_210237.t1:exon:812:1703820..1704119 -
MSAD_210237.t1:exon:811exonMSAD_210237.t1:exon:811:1717587..1717616 -
MSAD_210237.t1:exon:810exonMSAD_210237.t1:exon:810:1717968..1718086 -
MSAD_210237.t1:exon:809exonMSAD_210237.t1:exon:809:1718184..1718422 -
MSAD_210237.t1:exon:808exonMSAD_210237.t1:exon:808:1718562..1718618 -
MSAD_210237.t1:exon:807exonMSAD_210237.t1:exon:807:1718701..1718780 -
MSAD_210237.t1:exon:806exonMSAD_210237.t1:exon:806:1719357..1719896 -
MSAD_210237.t1:exon:805exonMSAD_210237.t1:exon:805:1722134..1722487 -
MSAD_210237.t1:cdsCDSMSAD_210237.t1:cds:1722134..1722430 -
MSAD_210237.t1:cdsCDSMSAD_210237.t1:cds:1719357..1719896 -
MSAD_210237.t1:cdsCDSMSAD_210237.t1:cds:1718701..1718780 -
MSAD_210237.t1:cdsCDSMSAD_210237.t1:cds:1718562..1718618 -
MSAD_210237.t1:cdsCDSMSAD_210237.t1:cds:1718184..1718422 -
MSAD_210237.t1:cdsCDSMSAD_210237.t1:cds:1717968..1718086 -
MSAD_210237.t1:cdsCDSMSAD_210237.t1:cds:1717587..1717616 -
MSAD_210237.t1:cdsCDSMSAD_210237.t1:cds:1703820..1704119 -
MSAD_210237.t1:cdsCDSMSAD_210237.t1:cds:1702400..1702939 -
MSAD_210237.t1:cdsCDSMSAD_210237.t1:cds:1701849..1701928 -
MSAD_210237.t1:cdsCDSMSAD_210237.t1:cds:1701706..1701762 -
MSAD_210237.t1:cdsCDSMSAD_210237.t1:cds:1701206..1701444 -
MSAD_210237.t1:cdsCDSMSAD_210237.t1:cds:1700985..1701103 -
MSAD_210237.t1:cdsCDSMSAD_210237.t1:cds:1700223..1700345 -
MSAD_210237.t1:cdsCDSMSAD_210237.t1:cds:1696173..1696547 -
MSAD_210237.t1:cdsCDSMSAD_210237.t1:cds:1694652..1695202 -
MSAD_210237.t1:cdsCDSMSAD_210237.t1:cds:1693740..1693796 -
MSAD_210237.t1:cdsCDSMSAD_210237.t1:cds:1693227..1693465 -
MSAD_210237.t1:cdsCDSMSAD_210237.t1:cds:1693015..1693133 -
MSAD_210237.t1:cdsCDSMSAD_210237.t1:cds:1692775..1692900 -
MSAD_210237.t1:cdsCDSMSAD_210237.t1:cds:1689735..1689770 -
MSAD_210243geneMSAD_210243:1748477..1749602 -
MSAD_210243.t1mRNAMSAD_210243.t1:1748477..1749602 -
MSAD_210243.t1:exon:827exonMSAD_210243.t1:exon:827:1748790..1749602 -
MSAD_210243.t1:exon:826exonMSAD_210243.t1:exon:826:1748477..1748740 -
MSAD_210243.t1:cdsCDSMSAD_210243.t1:cds:1748790..1749602 -
MSAD_210243.t1:cdsCDSMSAD_210243.t1:cds:1748477..1748740 -
MSAD_210234geneMSAD_210234:1656204..1687338 -
MSAD_210234.t1mRNAMSAD_210234.t1:1656204..1687338 -
MSAD_210234.t1:exon:838exonMSAD_210234.t1:exon:838:1656204..1656452 -
MSAD_210234.t1:exon:837exonMSAD_210234.t1:exon:837:1656547..1656665 -
MSAD_210234.t1:exon:836exonMSAD_210234.t1:exon:836:1656765..1657003 -
MSAD_210234.t1:exon:835exonMSAD_210234.t1:exon:835:1657464..1657520 -
MSAD_210234.t1:exon:834exonMSAD_210234.t1:exon:834:1658281..1658825 -
MSAD_210234.t1:exon:833exonMSAD_210234.t1:exon:833:1659735..1659956 -
MSAD_210234.t1:exon:832exonMSAD_210234.t1:exon:832:1686203..1686322 -
MSAD_210234.t1:exon:831exonMSAD_210234.t1:exon:831:1686415..1686533 -
MSAD_210234.t1:exon:830exonMSAD_210234.t1:exon:830:1686627..1686865 -
MSAD_210234.t1:exon:829exonMSAD_210234.t1:exon:829:1687142..1687198 -
MSAD_210234.t1:exon:828exonMSAD_210234.t1:exon:828:1687271..1687338 -
MSAD_210234.t1:cdsCDSMSAD_210234.t1:cds:1687271..1687338 -
MSAD_210234.t1:cdsCDSMSAD_210234.t1:cds:1687142..1687198 -
MSAD_210234.t1:cdsCDSMSAD_210234.t1:cds:1686627..1686865 -
MSAD_210234.t1:cdsCDSMSAD_210234.t1:cds:1686415..1686533 -
MSAD_210234.t1:cdsCDSMSAD_210234.t1:cds:1686203..1686322 -
MSAD_210234.t1:cdsCDSMSAD_210234.t1:cds:1659735..1659956 -
MSAD_210234.t1:cdsCDSMSAD_210234.t1:cds:1658281..1658825 -
MSAD_210234.t1:cdsCDSMSAD_210234.t1:cds:1657464..1657520 -
MSAD_210234.t1:cdsCDSMSAD_210234.t1:cds:1656765..1657003 -
MSAD_210234.t1:cdsCDSMSAD_210234.t1:cds:1656547..1656665 -
MSAD_210234.t1:cdsCDSMSAD_210234.t1:cds:1656273..1656452 -
MSAD_210244geneMSAD_210244:1754824..1755183 -
MSAD_210244.t1mRNAMSAD_210244.t1:1754824..1755183 -
MSAD_210244.t1:exon:839exonMSAD_210244.t1:exon:839:1754824..1755183 -
MSAD_210244.t1:cdsCDSMSAD_210244.t1:cds:1754824..1755183 -
MSAD_210245geneMSAD_210245:1796140..1802625 -
MSAD_210245.t1mRNAMSAD_210245.t1:1796140..1802625 -
MSAD_210245.t1:exon:841exonMSAD_210245.t1:exon:841:1802404..1802625 -
MSAD_210245.t1:exon:840exonMSAD_210245.t1:exon:840:1796140..1796344 -
MSAD_210245.t1:cdsCDSMSAD_210245.t1:cds:1802404..1802564 -
MSAD_210245.t1:cdsCDSMSAD_210245.t1:cds:1796140..1796344 -
spada-h102812.01genespada-h102812.01:858128..858744 -
spada-c602_Scc4a34_26_0M_1mRNAspada-c602_Scc4a34_26_0M_1:858128..858744 -
MSAD_210152.t1-exon-Scc4a34_26-1492110926:858725..858744exonMSAD_210152.t1-exon-Scc4a34_26-1492110926:858725..858744:858725..858744 -
MSAD_210152.t1-exon-Scc4a34_26-1492110926:858424..858584exonMSAD_210152.t1-exon-Scc4a34_26-1492110926:858424..858584:858424..858584 -
MSAD_210152.t1-exon-Scc4a34_26-1492110926:858128..858183exonMSAD_210152.t1-exon-Scc4a34_26-1492110926:858128..858183:858128..858183 -
MSAD_210152.t1-CDS-Scc4a34_26-1492110926:858725..858744CDSMSAD_210152.t1-CDS-Scc4a34_26-1492110926:858725..858744:858725..858744 -
MSAD_210152.t1-CDS-Scc4a34_26-1492110926:858424..858584CDSMSAD_210152.t1-CDS-Scc4a34_26-1492110926:858424..858584:858424..858584 -
MSAD_210152.t1-CDS-Scc4a34_26-1492110926:858128..858183CDSMSAD_210152.t1-CDS-Scc4a34_26-1492110926:858128..858183:858128..858183 -
Analyses
This supercontig is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
Sequence

Variant Marked-up Sequence

>Scc4a34_26:1-500
        GATCAGGTTCTGGTAGCTTCAGAACCTGTATCTTGCAGAACTTTCACCTTGCTTTGAAGTTTATCTTCAAGCTCCTTGTCATCAAATTTAACGTGCATAGATTCTTCAACACAAAGTGTTTCTGAATTATACACTCTGTATGCTTTGACCTTTCAGAGTAACCTAAAAAGATTCCCCTTTGGGCCTTGGCATCAAATTTCTTTAGGTAGAGCTTGTTGTTCAGAATGTAACATGTACATCCAAATTGATGAAAGTAAGAGATATTGGGTTTTCTTCCTTTAAAGAGTTCATATGCTGTTTTCTCCAAAATAGGTCTAATATAGATCCTGTTCTGAACATAGCATGCTGTATTCACTGCTTCTGCCCAAAAATGTTTTGGTAAATTGTTTTCATGAATCATGGTTCTGGCCATTTCTTGTAAAGTTCTATTCTTTCTCTCTACAACCCATTTTGTTGTGGTGTTCTAGGAGAAGAGAACTCATGGAAAATTCCATGTTTTT      

FASTA Record

The following sequence is that of the supercontig without any variants taken into account.

>Scc4a34_26:1-500
        GATCAGGTTCTGGTAGCTTCAGAACCTGTATCTTGCAGAACTTTCACCTTGCTTTGAAGTTTATCTTCAAGCTCCTTGTCATCAAATTTAACGTGCATAGATTCTTCAACACAAAGTGTTTCTGAATTATACACTCTGTATGCTTTGACCTTTCAGAGTAACCTAAAAAGATTCCCCTTTGGGCCTTGGCATCAAATTTCTTTAGGTAGAGCTTGTTGTTCAGAATGTAACATGTACATCCAAATTGATGAAAGTAAGAGATATTGGGTTTTCTTCCTTTAAAGAGTTCATATGCTGTTTTCTCCAAAATAGGTCTAATATAGATCCTGTTCTGAACATAGCATGCTGTATTCACTGCTTCTGCCCAAAAATGTTTTGGTAAATTGTTTTCATGAATCATGGTTCTGGCCATTTCTTGTAAAGTTCTATTCTTTCTCTCTACAACCCATTTTGTTGTGGTGTTCTAGGAGAAGAGAACTCATGGAAAATTCCATGTTTTT