Scc4a34_9 (supercontig; Medicago sativa )

Overview
NameScc4a34_9
Unique NameScc4a34_9
Typesupercontig
OrganismMedicago sativa (alfalfa)
Sequence length6962
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
MSAD_210009geneMSAD_210009:16..856 +
MSAD_210009.t1mRNAMSAD_210009.t1:16..856 +
MSAD_210009.t1:exon:0exonMSAD_210009.t1:exon:0:16..82 +
MSAD_210009.t1:exon:1exonMSAD_210009.t1:exon:1:169..268 +
MSAD_210009.t1:exon:2exonMSAD_210009.t1:exon:2:376..452 +
MSAD_210009.t1:exon:3exonMSAD_210009.t1:exon:3:539..637 +
MSAD_210009.t1:exon:4exonMSAD_210009.t1:exon:4:717..856 +
MSAD_210009.t1:cdsCDSMSAD_210009.t1:cds:16..82 +
MSAD_210009.t1:cdsCDSMSAD_210009.t1:cds:169..268 +
MSAD_210009.t1:cdsCDSMSAD_210009.t1:cds:376..452 +
MSAD_210009.t1:cdsCDSMSAD_210009.t1:cds:539..637 +
MSAD_210009.t1:cdsCDSMSAD_210009.t1:cds:717..856 +
MSAD_210011geneMSAD_210011:1633..2028 +
MSAD_210011.t1mRNAMSAD_210011.t1:1633..2028 +
MSAD_210011.t1:exon:5exonMSAD_210011.t1:exon:5:1633..1734 +
MSAD_210011.t1:exon:6exonMSAD_210011.t1:exon:6:1768..2028 +
MSAD_210011.t1:cdsCDSMSAD_210011.t1:cds:1633..1734 +
MSAD_210011.t1:cdsCDSMSAD_210011.t1:cds:1768..2028 +
MSAD_210010geneMSAD_210010:896..1223 +
MSAD_210010.t1mRNAMSAD_210010.t1:896..1223 +
MSAD_210010.t1:exon:7exonMSAD_210010.t1:exon:7:896..1007 +
MSAD_210010.t1:exon:8exonMSAD_210010.t1:exon:8:1084..1223 +
MSAD_210010.t1:cdsCDSMSAD_210010.t1:cds:896..1007 +
MSAD_210010.t1:cdsCDSMSAD_210010.t1:cds:1084..1223 +
MSAD_210020geneMSAD_210020:6457..6789 +
MSAD_210020.t1mRNAMSAD_210020.t1:6457..6789 +
MSAD_210020.t1:exon:9exonMSAD_210020.t1:exon:9:6457..6568 +
MSAD_210020.t1:exon:10exonMSAD_210020.t1:exon:10:6650..6789 +
MSAD_210020.t1:cdsCDSMSAD_210020.t1:cds:6457..6568 +
MSAD_210020.t1:cdsCDSMSAD_210020.t1:cds:6650..6789 +
MSAD_210015geneMSAD_210015:3857..4189 +
MSAD_210015.t1mRNAMSAD_210015.t1:3857..4189 +
MSAD_210015.t1:exon:11exonMSAD_210015.t1:exon:11:3857..3968 +
MSAD_210015.t1:exon:12exonMSAD_210015.t1:exon:12:4050..4189 +
MSAD_210015.t1:cdsCDSMSAD_210015.t1:cds:3857..3968 +
MSAD_210015.t1:cdsCDSMSAD_210015.t1:cds:4050..4189 +
MSAD_210018geneMSAD_210018:5343..5674 +
MSAD_210018.t1mRNAMSAD_210018.t1:5343..5674 +
MSAD_210018.t1:exon:13exonMSAD_210018.t1:exon:13:5343..5454 +
MSAD_210018.t1:exon:14exonMSAD_210018.t1:exon:14:5535..5674 +
MSAD_210018.t1:cdsCDSMSAD_210018.t1:cds:5343..5454 +
MSAD_210018.t1:cdsCDSMSAD_210018.t1:cds:5535..5674 +
MSAD_210016geneMSAD_210016:4229..4745 +
MSAD_210016.t1mRNAMSAD_210016.t1:4229..4745 +
MSAD_210016.t1:exon:15exonMSAD_210016.t1:exon:15:4229..4340 +
MSAD_210016.t1:exon:16exonMSAD_210016.t1:exon:16:4606..4745 +
MSAD_210016.t1:cdsCDSMSAD_210016.t1:cds:4229..4340 +
MSAD_210016.t1:cdsCDSMSAD_210016.t1:cds:4606..4745 +
MSAD_210014geneMSAD_210014:3487..3818 +
MSAD_210014.t1mRNAMSAD_210014.t1:3487..3818 +
MSAD_210014.t1:exon:17exonMSAD_210014.t1:exon:17:3487..3598 +
MSAD_210014.t1:exon:18exonMSAD_210014.t1:exon:18:3685..3818 +
MSAD_210014.t1:cdsCDSMSAD_210014.t1:cds:3487..3598 +
MSAD_210014.t1:cdsCDSMSAD_210014.t1:cds:3685..3818 +
MSAD_210019geneMSAD_210019:6084..6417 +
MSAD_210019.t1mRNAMSAD_210019.t1:6084..6417 +
MSAD_210019.t1:exon:19exonMSAD_210019.t1:exon:19:6084..6196 +
MSAD_210019.t1:exon:20exonMSAD_210019.t1:exon:20:6306..6417 +
MSAD_210019.t1:cdsCDSMSAD_210019.t1:cds:6084..6196 +
MSAD_210019.t1:cdsCDSMSAD_210019.t1:cds:6306..6417 +
MSAD_210012geneMSAD_210012:2190..2523 +
MSAD_210012.t1mRNAMSAD_210012.t1:2190..2523 +
MSAD_210012.t1:exon:21exonMSAD_210012.t1:exon:21:2190..2302 +
MSAD_210012.t1:exon:22exonMSAD_210012.t1:exon:22:2412..2523 +
MSAD_210012.t1:cdsCDSMSAD_210012.t1:cds:2190..2302 +
MSAD_210012.t1:cdsCDSMSAD_210012.t1:cds:2412..2523 +
Analyses
This supercontig is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
Sequence

Variant Marked-up Sequence

>Scc4a34_9:1-500
        ctaggaactattacatgcttcgattcgataaggctaggccactttatgccctttttagtgaaagaaaaaggtcaaaaacgagtaaaatccgtaaattaacaaggaaattcacttaaccccattttggccgtttttgaaaattctaaaatcaaccatggaagtcgtagatatgctcgttagatttcctaggaactattacatgcttcgattcgataaggctaggccactttatgccctttttagtgaaagaaaaagggtcaaaaacgagtaaaatccgtaaattaacaaggaaattcactaacccccattttggcctttttgaaaattctaaaatcaaccatggaagtcgtagatatgctcgttagatttcctaggaactattacatgcttcgattcgataaggctaggccactttatgccctttttagtgaaagaaaaaggtcaaaaacgagtaaaatccgtaaattaacaaggaaattcacttaaccccattttggccg      

FASTA Record

The following sequence is that of the supercontig without any variants taken into account.

>Scc4a34_9:1-500
        ctaggaactattacatgcttcgattcgataaggctaggccactttatgccctttttagtgaaagaaaaaggtcaaaaacgagtaaaatccgtaaattaacaaggaaattcacttaaccccattttggccgtttttgaaaattctaaaatcaaccatggaagtcgtagatatgctcgttagatttcctaggaactattacatgcttcgattcgataaggctaggccactttatgccctttttagtgaaagaaaaagggtcaaaaacgagtaaaatccgtaaattaacaaggaaattcactaacccccattttggcctttttgaaaattctaaaatcaaccatggaagtcgtagatatgctcgttagatttcctaggaactattacatgcttcgattcgataaggctaggccactttatgccctttttagtgaaagaaaaaggtcaaaaacgagtaaaatccgtaaattaacaaggaaattcacttaaccccattttggccg